DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results


Pathway : Na+-dependent glucose transporters, 23 clones found

No of Result Per Page : Page: Explanation of Terms
Plasmid ID
Keywords Reference
Vector Selection
1 HsCD00073547 Plasmid Details cDNA SLC5A1 solute carrier family 5 (sodium/glucose cotransporter), member 1 NA CR456579 No/No FUSION pENTR223 bacterial:spectinomycin
2 HsCD00073641 Plasmid Details cDNA SLC5A1 solute carrier family 5 (sodium/glucose cotransporter), member 1 NA CR456579 No/No CLOSED pENTR223 bacterial:spectinomycin
3 HsCD00080115 Plasmid Details cDNA SLC5A1 solute carrier family 5 (sodium/glucose cotransporter), member 1 NA NM_000343 No/No CLOSED pENTR223.1 bacterial:spectinomycin
4 HsCD00080138 Plasmid Details cDNA SLC5A3 solute carrier family 5 (inositol transporters), member 3 NA NM_006933 No/No CLOSED pENTR223.1 bacterial:spectinomycin
5 HsCD00080449 Plasmid Details cDNA SLC5A1 solute carrier family 5 (sodium/glucose cotransporter), member 1 NA NM_000343 No/No FUSION pENTR223.1 bacterial:spectinomycin
6 HsCD00080472 Plasmid Details cDNA SLC5A4 solute carrier family 5 (low affinity glucose cotransporter), member 4 NA NM_014227 No/No FUSION pENTR223.1 bacterial:spectinomycin
7 HsCD00081271 Plasmid Details cDNA SLC5A3 solute carrier family 5 (inositol transporters), member 3 NA NM_006933 No/No FUSION pENTR223.1 bacterial:spectinomycin
8 HsCD00297349 Plasmid Details cDNA SLC5A4 solute carrier family 5 (low affinity glucose cotransporter), member 4 NA NM_014227.1 No/No CLOSED pENTR223.1 bacterial:spectinomycin
9 HsCD00301161 Plasmid Details cDNA SLC5A1 solute carrier family 5 (sodium/glucose cotransporter), member 1 NA CR456579 No/No FUSION pANT7_cGST bacterial:ampicillin
10 HsCD00302744 Plasmid Details cDNA SLC5A4 solute carrier family 5 (low affinity glucose cotransporter), member 4 NA NM_014227 No/No FUSION pANT7_cGST bacterial:ampicillin
11 HsCD00350531 Plasmid Details cDNA SLC5A1 solute carrier family 5 (sodium/glucose cotransporter), member 1 NA CU013176 No/No CLOSED pENTR223 bacterial:spectinomycin
12 HsCD00350751 Plasmid Details cDNA SLC5A4 solute carrier family 5 (low affinity glucose cotransporter), member 4 NA BC153069 No/No CLOSED pENTR223.1 bacterial:spectinomycin
13 HsCD00351107 Plasmid Details cDNA SLC5A1 solute carrier family 5 (sodium/glucose cotransporter), member 1 NA CU013464 No/No FUSION pENTR223 bacterial:spectinomycin
14 HsCD00356705 Plasmid Details cDNA SLC5A1 solute carrier family 5 (sodium/glucose cotransporter), member 1 NA CU013464 No/No FUSION pANT7_cGST bacterial:ampicillin
15 HsCD00440301 Plasmid Details cDNA SLC5A2 solute carrier family 5 (sodium/glucose cotransporter), member 2 NA No/No FUSION pLX304 mammalian:blasticidin
16 HsCD00512863 Plasmid Details cDNA SLC5A2 solute carrier family 5 (sodium/glucose cotransporter), member 2 NA No/No FUSION pENTR223 bacterial:spectinomycin
17 HsCD00516198 Plasmid Details cDNA SLC5A9 solute carrier family 5 (sodium/glucose cotransporter), member 9 NA No/No FUSION pENTR223 bacterial:spectinomycin
18 HsCD00627298 Plasmid Details cDNA SLC5A1 solute carrier family 5 (sodium/glucose cotransporter), member 1 codon-optimized sequence No/No CLOSED pPICZa bacterial:zeocin
19 HsCD00629427 Plasmid Details cDNA SLC5A2 solute carrier family 5 (sodium/glucose cotransporter), member 2 NA No/No FUSION pANT7_cGST bacterial:ampicillin
20 HsCD00640364 Plasmid Details cDNA SLC5A9 solute carrier family 5 (sodium/sugar cotransporter), member 9 NA NM_001135181 No/No FUSION pANT7_cGST bacterial:ampicillin
21 HsUT00698384 Plasmid Details 3'UTR LSM3 LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) Sequence Verified: Yes; 3'UTR length: 433; Forward Primer: CCACTGAGAGTTGGCTGA; Reverse Primer: CAGTAGGTGCACTGCAAATGTGT NM_014463 No/No NA P2RP3 bacterial:kanamycin
22 HsCD00731642 Plasmid Details cDNA SLC5A1 solute carrier family 5 (sodium/glucose cotransporter), member 1 NA NM_000343 No/No FUSION pANT7_cGST bacterial:ampicillin
23 HsCD00731674 Plasmid Details cDNA SLC5A3 solute carrier family 5 (sodium/myo-inositol cotransporter), member 3 NA NM_006933 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: