DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Plus-strand DNA synthesis, 8 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00041604 Plasmid Details cDNA PPIA peptidylprolyl isomerase A (cyclophilin A) NA BC000689 No/No FUSION pDONR221 bacterial:kanamycin
2 HsCD00044677 Plasmid Details cDNA PPIA peptidylprolyl isomerase A (cyclophilin A) NA BC000689 No/No CLOSED pDONR221 bacterial:kanamycin
3 HsCD00434362 Plasmid Details cDNA PPIA peptidylprolyl isomerase A (cyclophilin A) NA DQ895865 No/No FUSION pLX304 mammalian:blasticidin
4 HsCD00440961 Plasmid Details cDNA PPIA peptidylprolyl isomerase A (cyclophilin A) NA DQ895865 No/No FUSION pLX304 mammalian:blasticidin
5 HsCD00506343 Plasmid Details cDNA PPIA peptidylprolyl isomerase A (cyclophilin A) NA DQ895865 No/No FUSION pENTR223 bacterial:spectinomycin
6 HsCD00506397 Plasmid Details cDNA PPIA peptidylprolyl isomerase A (cyclophilin A) NA DQ895865 No/No FUSION pENTR223 bacterial:spectinomycin
7 HsUT00699294 Plasmid Details 3'UTR NHEJ1 nonhomologous end-joining factor 1 Sequence Verified: Yes; 3'UTR length: 1237; Forward Primer: AAGCCAAGGGGTCTCTTCAGTTAA; Reverse Primer: GACCTTTGATAAGTCACTTACTCACTTCAG NM_024782 No/No NA P2RP3 bacterial:kanamycin
8 HsCD00730944 Plasmid Details cDNA PPIA peptidylprolyl isomerase A (cyclophilin A) NA BC000689 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: