DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results


Pathway : Pregnenolone biosynthesis, 49 clones found

No of Result Per Page : Page: Explanation of Terms
Plasmid ID
Keywords Reference
Vector Selection
1 HsCD00000441 Plasmid Details cDNA AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) NA NM_001628 No/Yes FUSION pDNR-Dual bacterial:ampicillin
2 HsCD00000442 Plasmid Details cDNA AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) NA NM_001628 No/Yes FUSION pDNR-Dual bacterial:ampicillin
3 HsCD00000443 Plasmid Details cDNA AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) NA NM_001628 No/No CLOSED pDNR-Dual bacterial:ampicillin
4 HsCD00001197 Plasmid Details cDNA AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) NA NM_001628 No/No FUSION pDONR201 bacterial:kanamycin
5 HsCD00001198 Plasmid Details cDNA AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) NA NM_001628 No/No CLOSED pDONR201 bacterial:kanamycin
6 HsCD00001199 Plasmid Details cDNA AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) NA NM_001628 No/No CLOSED pDNR-Dual bacterial:ampicillin
7 HsCD00001200 Plasmid Details cDNA AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) NA NM_001628 No/No FUSION pDNR-Dual bacterial:ampicillin
8 HsCD00001201 Plasmid Details cDNA AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) NA NM_001628 No/No CLOSED pDNR-Dual bacterial:ampicillin
9 HsCD00001202 Plasmid Details cDNA AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) NA NM_001628 No/No CLOSED pDONR201 bacterial:kanamycin
10 HsCD00003027 Plasmid Details cDNA AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) NA BC000260 No/Yes FUSION pDNR-Dual bacterial:ampicillin
11 HsCD00003028 Plasmid Details cDNA AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) NA BC000260 No/No CLOSED pDNR-Dual bacterial:ampicillin
12 HsCD00005654 Plasmid Details cDNA CYP11A1 cytochrome P450, family 11, subfamily A, polypeptide 1 NA BC032329 No/No CLOSED pDNR-Dual bacterial:ampicillin
13 HsCD00039607 Plasmid Details cDNA AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) NA BC010391 No/No FUSION pDONR221 bacterial:kanamycin
14 HsCD00040434 Plasmid Details cDNA AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) NA BC000260 No/No FUSION pDONR221 bacterial:kanamycin
15 HsCD00040545 Plasmid Details cDNA CYP11A1 cytochrome P450, family 11, subfamily A, polypeptide 1 NA BC032329 No/No FUSION pDONR221 bacterial:kanamycin
16 HsCD00042775 Plasmid Details cDNA AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) NA BC010391 No/No CLOSED pDONR221 bacterial:kanamycin
17 HsCD00043571 Plasmid Details cDNA AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) NA BC000260 No/No CLOSED pDONR221 bacterial:kanamycin
18 HsCD00043661 Plasmid Details cDNA CYP11A1 cytochrome P450, family 11, subfamily A, polypeptide 1 NA BC032329 No/No CLOSED pDONR221 bacterial:kanamycin
19 HsCD00074926 Plasmid Details cDNA CYP11A1 cytochrome P450, family 11, subfamily A, polypeptide 1 NA BC032329 No/No CLOSED pJP1520 mammalian:puromycin
20 HsCD00075119 Plasmid Details cDNA CYP11A1 cytochrome P450, family 11, subfamily A, polypeptide 1 NA BC032329 No/No CLOSED pJP1520 mammalian:puromycin
21 HsCD00075236 Plasmid Details cDNA AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) NA NM_001628 No/No CLOSED pJP1520 mammalian:puromycin
22 HsCD00075237 Plasmid Details cDNA AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) NA NM_001628 No/No CLOSED pJP1520 mammalian:puromycin
23 HsCD00075312 Plasmid Details cDNA AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) NA NM_001628 No/No CLOSED pJP1520 mammalian:puromycin
24 HsCD00075353 Plasmid Details cDNA AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) NA BC000260 No/No CLOSED pJP1520 mammalian:puromycin
25 HsCD00075354 Plasmid Details cDNA AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) NA BC000260 No/No CLOSED pJP1520 mammalian:puromycin
26 HsCD00075524 Plasmid Details cDNA AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) NA NM_001628 No/No CLOSED pJP1520 mammalian:puromycin
27 HsCD00075525 Plasmid Details cDNA AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) NA NM_001628 No/No CLOSED pJP1520 mammalian:puromycin
28 HsCD00077930 Plasmid Details cDNA CYP11A1 cytochrome P450, family 11, subfamily A, polypeptide 1 NA BC032329 No/No FUSION pANT7_cGST bacterial:ampicillin
29 HsCD00078334 Plasmid Details cDNA AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) NA BC000260 No/No FUSION pANT7_cGST bacterial:ampicillin
30 HsCD00080166 Plasmid Details cDNA STARD6 START domain containing 6 NA NM_139171 No/No CLOSED pENTR223.1 bacterial:spectinomycin
31 HsCD00081253 Plasmid Details cDNA STARD6 START domain containing 6 NA NM_139171 No/No FUSION pENTR223.1 bacterial:spectinomycin
32 HsCD00305085 Plasmid Details cDNA AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) NA NM_001628 Unknown/Unknown FUSION pDONR201 bacterial:kanamycin
33 HsCD00343144 Plasmid Details cDNA AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) NA BC000260 No/No CLOSED pMCSG7 bacterial:ampicillin
34 HsCD00396676 Plasmid Details cDNA STARD5 StAR-related lipid transfer (START) domain containing 5 full-length cds BC004365 No/No CLOSED pVP16 bacterial:ampicillin
35 HsCD00397601 Plasmid Details cDNA STARD5 StAR-related lipid transfer (START) domain containing 5 full-length cds NM_181900 No/No CLOSED pVP56K bacterial:kanamycin
36 HsCD00429571 Plasmid Details cDNA STARD5 StAR-related lipid transfer (START) domain containing 5 full-length cds NM_181900 No/No CLOSED pVP16 bacterial:ampicillin
37 HsCD00434911 Plasmid Details cDNA STAR steroidogenic acute regulatory protein NA DQ894990 No/No FUSION pLX304 mammalian:blasticidin
38 HsCD00435328 Plasmid Details cDNA CYP11A1 cytochrome P450, family 11, subfamily A, polypeptide 1 NA No/Yes FUSION pLX304 mammalian:blasticidin
39 HsCD00441256 Plasmid Details cDNA AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) NA DQ895757 No/No FUSION pLX304 mammalian:blasticidin
40 HsCD00508803 Plasmid Details cDNA STAR steroidogenic acute regulatory protein NA DQ894990 No/No FUSION pENTR223 bacterial:spectinomycin
41 HsCD00509234 Plasmid Details cDNA AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) NA DQ895757 No/No FUSION pENTR223 bacterial:spectinomycin
42 HsCD00514987 Plasmid Details cDNA STARD5 StAR-related lipid transfer (START) domain containing 5 NA No/No FUSION pENTR223 bacterial:spectinomycin
43 HsCD00640251 Plasmid Details cDNA STARD5 StAR-related lipid transfer (START) domain containing 5 NA NM_181900 No/No FUSION pANT7_cGST bacterial:ampicillin
44 HsUT00699013 Plasmid Details 3'UTR FRAP1 mechanistic target of rapamycin (serine/threonine kinase) Sequence Verified: Yes; 3'UTR length: 1134; Forward Primer: CTTAGGTGCCCTTTCTGGTAA; Reverse Primer: TGGGAACAGTCTGAGGAAAGGGA NM_004958 No/No NA P2RP3 bacterial:kanamycin
45 HsCD00729961 Plasmid Details cDNA STAR steroidogenic acute regulatory protein NA BC010550 No/No FUSION pANT7_cGST bacterial:ampicillin
46 HsCD00730580 Plasmid Details cDNA STAR steroidogenic acute regulatory protein NA BC010550 No/No FUSION pANT7_cGST bacterial:ampicillin
47 HsCD00731445 Plasmid Details cDNA AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) NA BC010391 No/No FUSION pANT7_cGST bacterial:ampicillin
48 HsCD00731664 Plasmid Details cDNA STARD6 StAR-related lipid transfer (START) domain containing 6 NA NM_139171 No/No FUSION pANT7_cGST bacterial:ampicillin
49 HsCD00731787 Plasmid Details cDNA AKR1B1 aldo-keto reductase family 1, member B1 (aldose reductase) NA NM_001628 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: