DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Processing of DNA double-strand break ends, 16 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00004169 Plasmid Details cDNA RPA3 replication protein A3, 14kDa NA BC005264 No/No CLOSED pDNR-Dual bacterial:ampicillin
2 HsCD00041560 Plasmid Details cDNA RPA2 replication protein A2, 32kDa NA BC001630 No/No FUSION pDONR221 bacterial:kanamycin
3 HsCD00044415 Plasmid Details cDNA RPA2 replication protein A2, 32kDa NA BC001630 No/No CLOSED pDONR221 bacterial:kanamycin
4 HsCD00078624 Plasmid Details cDNA RPA2 replication protein A2, 32kDa NA BC001630 No/No FUSION pANT7_cGST bacterial:ampicillin
5 HsCD00353697 Plasmid Details cDNA RPA1 replication protein A1, 70kDa NA HQ258560 No/No FUSION pDONR223 bacterial:spectinomycin
6 HsCD00358218 Plasmid Details cDNA RPA2 replication protein A2, 32kDa NA P15927 No/No CLOSED pMCSG7 bacterial:ampicillin
7 HsCD00403449 Plasmid Details cDNA RPA1 replication protein A1, 70kDa NA HQ258560 No/No FUSION pANT7_cGST bacterial:ampicillin
8 HsCD00437663 Plasmid Details cDNA RPA3 replication protein A3, 14kDa NA No/Yes FUSION pLX304 mammalian:blasticidin
9 HsCD00442975 Plasmid Details cDNA RPA1 replication protein A1, 70kDa NA No/Yes FUSION pLX304 mammalian:blasticidin
10 HsCD00444191 Plasmid Details cDNA RPA2 replication protein A2, 32kDa NA DQ895821 No/No FUSION pLX304 mammalian:blasticidin
11 HsCD00508178 Plasmid Details cDNA RPA2 replication protein A2, 32kDa NA DQ895821 No/No FUSION pENTR223 bacterial:spectinomycin
12 HsCD00547444 Plasmid Details cDNA RPA3 replication protein A3, 14kDa NA BC009868 No/No CLOSED pSpeedET bacterial:kanamycin
13 HsCD00618172 Plasmid Details cDNA RPA3 replication protein A3, 14kDa NA BC005264 No/No CLOSED pLDNT7_nFLAG bacterial:chloramphenicol
14 HsCD00664984 Plasmid Details cDNA RPA2 "replication protein A2, 32kDa" targeted domain No/No CLOSED pET15Nano6HT_NESG bacterial:ampicillin
15 HsUT00698400 Plasmid Details 3'UTR EPHA6 EPH receptor A6 Sequence Verified: Yes; 3'UTR length: 427; Forward Primer: CTAACACTTAACCTCTGCTATTCTGCATAA; Reverse Primer: CTTTTTTCTCGCTGCAAACTTTTTACACCA NM_173655 No/No NA P2RP3 bacterial:kanamycin
16 HsCD00745352 Plasmid Details cDNA RPA3 replication protein A3, 14kDa NA BC005264.1 No/No FUSION pDONR221 bacterial:kanamycin
No of Result Per Page : Page: