DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Alternative complement activation, 9 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00398882 Plasmid Details cDNA GZMM granzyme M (lymphocyte met-ase 1) NA HQ257986 No/No FUSION pDONR223 bacterial:spectinomycin
2 HsCD00403949 Plasmid Details cDNA GZMM granzyme M (lymphocyte met-ase 1) NA HQ257986 No/No FUSION pANT7_cGST bacterial:ampicillin
3 HsCD00444098 Plasmid Details cDNA CFB complement factor B NA DQ895516 No/No FUSION pLX304 mammalian:blasticidin
4 HsCD00446291 Plasmid Details cDNA GZMM granzyme M (lymphocyte met-ase 1) NA HQ257986 No/No FUSION pLX304 mammalian:blasticidin
5 HsCD00505660 Plasmid Details cDNA CFB complement factor B NA DQ895516 No/No FUSION pENTR223 bacterial:spectinomycin
6 HsCD00512728 Plasmid Details cDNA GZMM granzyme M (lymphocyte met-ase 1) NA HQ257986 No/No FUSION pENTR223 bacterial:spectinomycin
7 HsUT00698179 Plasmid Details 3'UTR TADA1L transcriptional adaptor 1 Sequence Verified: Yes; 3'UTR length: 1235; Forward Primer: GGGCTTTTGCTGTGCTAA; Reverse Primer: AAATGGCATACCTTAGTTGGAATCTGCTTT NM_053053 No/No NA P2RP3 bacterial:kanamycin
8 HsUT00699370 Plasmid Details 3'UTR LMNA lamin A/C Sequence Verified: Yes; 3'UTR length: 1163; Forward Primer: CAGAACTGCAGCATCATGTAA; Reverse Primer: CAATGAGCAGGAGGATGCAGTGA NM_170708 No/No NA P2RP3 bacterial:kanamycin
9 HsCD00730844 Plasmid Details cDNA CFB complement factor B NA BC004143 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: