DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Prostanoid ligand receptors, 33 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00001381 Plasmid Details cDNA PTGFR prostaglandin F receptor (FP) NA NM_000959 No/Yes CLOSED pDONR201 bacterial:kanamycin
2 HsCD00005735 Plasmid Details cDNA PTGFR prostaglandin F receptor (FP) NA BC035694 No/No FUSION pDNR-Dual bacterial:ampicillin
3 HsCD00039806 Plasmid Details cDNA PTGFR prostaglandin F receptor (FP) NA BC035694 No/No FUSION pDONR221 bacterial:kanamycin
4 HsCD00042974 Plasmid Details cDNA PTGFR prostaglandin F receptor (FP) NA BC035694 No/No CLOSED pDONR221 bacterial:kanamycin
5 HsCD00288183 Plasmid Details cDNA PTGER3 prostaglandin E receptor 3 (subtype EP3) NA BC024229.1 No/No FUSION pENTR223 bacterial:spectinomycin
6 HsCD00304941 Plasmid Details cDNA PTGIR prostaglandin I2 (prostacyclin) receptor (IP) NA NM_000960 Unknown/Unknown FUSION pDONR201 bacterial:kanamycin
7 HsCD00304942 Plasmid Details cDNA PTGER2 prostaglandin E receptor 2 (subtype EP2), 53kDa NA NM_000956 Unknown/Unknown FUSION pDONR201 bacterial:kanamycin
8 HsCD00305151 Plasmid Details cDNA PTGFR prostaglandin F receptor (FP) NA NM_000959 Unknown/Unknown FUSION pDONR201 bacterial:kanamycin
9 HsCD00305155 Plasmid Details cDNA PTGER1 prostaglandin E receptor 1 (subtype EP1), 42kDa NA NM_000955 Unknown/Unknown FUSION pDONR201 bacterial:kanamycin
10 HsCD00305172 Plasmid Details cDNA GPR44 G protein-coupled receptor 44 NA NM_004778 Unknown/Unknown FUSION pDONR201 bacterial:kanamycin
11 HsCD00305296 Plasmid Details cDNA PTGER2 prostaglandin E receptor 2 (subtype EP2), 53kDa NA NM_000956 Unknown/Unknown FUSION pANT7_cGST bacterial:ampicillin
12 HsCD00352712 Plasmid Details cDNA PTGER3 prostaglandin E receptor 3 (subtype EP3) NA HQ447638 No/No FUSION pDONR223 bacterial:spectinomycin
13 HsCD00353806 Plasmid Details cDNA PTGER4 prostaglandin E receptor 4 (subtype EP4) NA HQ258444 No/No FUSION pDONR223 bacterial:spectinomycin
14 HsCD00357885 Plasmid Details cDNA PTGER3 prostaglandin E receptor 3 (subtype EP3) NA HQ447638 No/No FUSION pANT7_cGST bacterial:ampicillin
15 HsCD00403541 Plasmid Details cDNA PTGER4 prostaglandin E receptor 4 (subtype EP4) NA HQ258444 No/No FUSION pANT7_cGST bacterial:ampicillin
16 HsCD00443435 Plasmid Details cDNA PTGER3 prostaglandin E receptor 3 (subtype EP3) NA HQ447638 No/No FUSION pLX304 mammalian:blasticidin
17 HsCD00446102 Plasmid Details cDNA PTGIR prostaglandin I2 (prostacyclin) receptor (IP) NA No/No FUSION pLX304 mammalian:blasticidin
18 HsCD00446706 Plasmid Details cDNA PTGER4 prostaglandin E receptor 4 (subtype EP4) NA HQ258444 No/No FUSION pLX304 mammalian:blasticidin
19 HsCD00511884 Plasmid Details cDNA PTGER3 prostaglandin E receptor 3 (subtype EP3) NA HQ447638 No/No FUSION pENTR223 bacterial:spectinomycin
20 HsCD00513013 Plasmid Details cDNA PTGER4 prostaglandin E receptor 4 (subtype EP4) NA HQ258444 No/No FUSION pENTR223 bacterial:spectinomycin
21 HsCD00515133 Plasmid Details cDNA TBXA2R thromboxane A2 receptor NA No/No FUSION pENTR223 bacterial:spectinomycin
22 HsCD00515548 Plasmid Details cDNA PTGDR prostaglandin D2 receptor (DP) NA No/No FUSION pENTR223 bacterial:spectinomycin
23 HsCD00622758 Plasmid Details cDNA PTGIR prostaglandin I2 (prostacyclin) receptor (IP) PERFECT_MATCH BC075814.1 No/No FUSION pENTR223 bacterial:spectinomycin
24 HsCD00631018 Plasmid Details cDNA PTGDR prostaglandin D2 receptor (DP) NA No/No FUSION pANT7_cGST bacterial:ampicillin
25 HsCD00639348 Plasmid Details cDNA TBXA2R thromboxane A2 receptor NA No/No FUSION pANT7_cGST bacterial:ampicillin
26 HsCD00674759 Plasmid Details cDNA TBXA2R thromboxane A2 receptor NA BC074749 No/No FUSION pANT7_cGST bacterial:ampicillin
27 HsUT00698717 Plasmid Details 3'UTR ZNF193 zinc finger and SCAN domain containing 9 Sequence Verified: Yes; 3'UTR length: 488; Forward Primer: GTGGCTGAGCTGGTCTAG; Reverse Primer: GAGAGTCACGTAGGTGTCAGAGAGAA NM_001199480 No/No NA P2RP3 bacterial:kanamycin
28 HsCD00719173 Plasmid Details cDNA TBXA2R thromboxane A2 receptor NA BC074749 No/No FUSION pDONR221 bacterial:kanamycin
29 HsCD00719360 Plasmid Details cDNA PTGER3 prostaglandin E receptor 3 (subtype EP3) NA BC118659 No/No FUSION pDONR221 bacterial:kanamycin
30 HsCD00730072 Plasmid Details cDNA PTGER1 prostaglandin E receptor 1 (subtype EP1), 42kDa NA NM_000955 No/No FUSION pANT7_cGST bacterial:ampicillin
31 HsCD00731727 Plasmid Details cDNA PTGIR prostaglandin I2 (prostacyclin) receptor (IP) NA NM_000960 No/No FUSION pANT7_cGST bacterial:ampicillin
32 HsCD00731834 Plasmid Details cDNA PTGDR2 prostaglandin D2 receptor 2 NA NM_004778 No/No FUSION pANT7_cGST bacterial:ampicillin
33 HsCD00732086 Plasmid Details cDNA PTGER3 prostaglandin E receptor 3 (subtype EP3) NA BC024229 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: