DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Recycling of bile acids and salts, 50 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00000432 Plasmid Details cDNA BAAT bile acid Coenzyme A: amino acid N-acyltransferase (glycine N-choloyltransferase) NA NM_001701 No/No FUSION pDONR201 bacterial:kanamycin
2 HsCD00005810 Plasmid Details cDNA ALB albumin NA BC036003 No/No FUSION pDNR-Dual bacterial:ampicillin
3 HsCD00040274 Plasmid Details cDNA ALB albumin NA BC034023 No/No FUSION pDONR221 bacterial:kanamycin
4 HsCD00040857 Plasmid Details cDNA BAAT bile acid Coenzyme A: amino acid N-acyltransferase (glycine N-choloyltransferase) NA BC009567 No/No FUSION pDONR221 bacterial:kanamycin
5 HsCD00043431 Plasmid Details cDNA ALB albumin NA BC034023 No/No CLOSED pDONR221 bacterial:kanamycin
6 HsCD00043983 Plasmid Details cDNA BAAT bile acid Coenzyme A: amino acid N-acyltransferase (glycine N-choloyltransferase) NA BC009567 No/No CLOSED pDONR221 bacterial:kanamycin
7 HsCD00080305 Plasmid Details cDNA SLC27A5 solute carrier family 27 (fatty acid transporter), member 5 NA NM_012254 No/No FUSION pENTR223.1 bacterial:spectinomycin
8 HsCD00081278 Plasmid Details cDNA SLCO1B3 solute carrier organic anion transporter family, member 1B3 NA NM_019844 No/No FUSION pENTR223.1 bacterial:spectinomycin
9 HsCD00082956 Plasmid Details cDNA SLC27A5 solute carrier family 27 (fatty acid transporter), member 5 NA NM_012254 No/No CLOSED pENTR223.1 bacterial:spectinomycin
10 HsCD00287982 Plasmid Details cDNA SLC10A1 solute carrier family 10 (sodium/bile acid cotransporter family), member 1 NA BC069822.1 No/No FUSION pENTR223 bacterial:spectinomycin
11 HsCD00288921 Plasmid Details cDNA FABP6 fatty acid binding protein 6, ileal (gastrotropin) NA BC022489.1 No/No FUSION pENTR223 bacterial:spectinomycin
12 HsCD00302607 Plasmid Details cDNA SLCO1B3 solute carrier organic anion transporter family, member 1B3 NA NM_019844 No/No FUSION pANT7_cGST bacterial:ampicillin
13 HsCD00304067 Plasmid Details cDNA SLC10A1 solute carrier family 10 (sodium/bile acid cotransporter family), member 1 NA BC069822.1 No/No FUSION pANT7_cGST bacterial:ampicillin
14 HsCD00343249 Plasmid Details cDNA ALB albumin NA BC036003 No/No FUSION pMCSG7 bacterial:ampicillin
15 HsCD00351968 Plasmid Details cDNA FABP6 fatty acid binding protein 6, ileal NA HQ448339 No/No FUSION pDONR223 bacterial:spectinomycin
16 HsCD00353139 Plasmid Details cDNA SLC10A1 solute carrier family 10 (sodium/bile acid cotransporter family), member 1 NA HQ447437 No/No FUSION pDONR223 bacterial:spectinomycin
17 HsCD00353602 Plasmid Details cDNA SLC10A2 solute carrier family 10 (sodium/bile acid cotransporter family), member 2 NA HQ258177 No/No FUSION pDONR223 bacterial:spectinomycin
18 HsCD00353603 Plasmid Details cDNA SLC10A1 solute carrier family 10 (sodium/bile acid cotransporter family), member 1 NA HQ258189 No/No FUSION pDONR223 bacterial:spectinomycin
19 HsCD00356129 Plasmid Details cDNA FABP6 fatty acid binding protein 6, ileal NA HQ448339 No/No FUSION pANT7_cGST bacterial:ampicillin
20 HsCD00356914 Plasmid Details cDNA SLC10A1 solute carrier family 10 (sodium/bile acid cotransporter family), member 1 NA HQ447437 No/No FUSION pANT7_cGST bacterial:ampicillin
21 HsCD00403376 Plasmid Details cDNA SLC10A2 solute carrier family 10 (sodium/bile acid cotransporter family), member 2 NA HQ258177 No/No FUSION pANT7_cGST bacterial:ampicillin
22 HsCD00403377 Plasmid Details cDNA SLC10A1 solute carrier family 10 (sodium/bile acid cotransporter family), member 1 NA HQ258189 No/No FUSION pANT7_cGST bacterial:ampicillin
23 HsCD00429792 Plasmid Details cDNA BAAT bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase) full-length cds BC107424 No/No CLOSED pDONR221 bacterial:kanamycin
24 HsCD00439496 Plasmid Details cDNA SLC10A1 solute carrier family 10 (sodium/bile acid cotransporter family), member 1 NA HQ447437 No/No FUSION pLX304 mammalian:blasticidin
25 HsCD00440136 Plasmid Details cDNA SLC10A2 solute carrier family 10 (sodium/bile acid cotransporter family), member 2 NA HQ258177 No/No FUSION pLX304 mammalian:blasticidin
26 HsCD00440535 Plasmid Details cDNA BAAT bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase) NA DQ895095 No/No FUSION pLX304 mammalian:blasticidin
27 HsCD00443578 Plasmid Details cDNA SLCO1B1 solute carrier organic anion transporter family, member 1B1 NA No/No FUSION pLX304 mammalian:blasticidin
28 HsCD00445336 Plasmid Details cDNA FABP6 fatty acid binding protein 6, ileal NA HQ448339 No/No FUSION pLX304 mammalian:blasticidin
29 HsCD00446789 Plasmid Details cDNA SLC10A6 solute carrier family 10 (sodium/bile acid cotransporter family), member 6 NA No/No FUSION pLX304 mammalian:blasticidin
30 HsCD00505085 Plasmid Details cDNA FABP6 fatty acid binding protein 6, ileal NA HQ448339 No/No FUSION pENTR223 bacterial:spectinomycin
31 HsCD00505441 Plasmid Details cDNA SLCO1B1 solute carrier organic anion transporter family, member 1B1 NA No/No FUSION pENTR223 bacterial:spectinomycin
32 HsCD00510696 Plasmid Details cDNA SLC10A1 solute carrier family 10 (sodium/bile acid cotransporter family), member 1 NA HQ447437 No/No FUSION pENTR223 bacterial:spectinomycin
33 HsCD00510705 Plasmid Details cDNA SLC10A2 solute carrier family 10 (sodium/bile acid cotransporter family), member 2 NA HQ258177 No/No FUSION pENTR223 bacterial:spectinomycin
34 HsCD00510943 Plasmid Details cDNA SLC10A6 solute carrier family 10 (sodium/bile acid cotransporter family), member 6 NA No/No FUSION pENTR223 bacterial:spectinomycin
35 HsCD00511397 Plasmid Details cDNA BAAT bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase) NA DQ895095 No/No FUSION pENTR223 bacterial:spectinomycin
36 HsCD00515629 Plasmid Details cDNA SLCO1A2 solute carrier organic anion transporter family, member 1A2 NA No/No FUSION pENTR223 bacterial:spectinomycin
37 HsCD00583085 Plasmid Details cDNA SLC10A1 solute carrier family 10 (sodium/bile acid cotransporter family), member 1 NA No/No FUSION pPICZa bacterial:zeocin
38 HsCD00583098 Plasmid Details cDNA SLC10A6 solute carrier family 10 (sodium/bile acid cotransporter family), member 6 NA No/No FUSION pPICZa bacterial:zeocin
39 HsCD00629293 Plasmid Details cDNA SLCO1A2 solute carrier organic anion transporter family, member 1A2 NA No/No FUSION pANT7_cGST bacterial:ampicillin
40 HsCD00630809 Plasmid Details cDNA SLC10A6 solute carrier family 10 (sodium/bile acid cotransporter), member 6 NA No/No FUSION pANT7_cGST bacterial:ampicillin
41 HsCD00640145 Plasmid Details cDNA SLCO1B1 solute carrier organic anion transporter family, member 1B1 NA NM_006446 No/No FUSION pANT7_cGST bacterial:ampicillin
42 HsUT00699103 Plasmid Details 3'UTR CAMTA1 calmodulin binding transcription activator 1 Sequence Verified: Yes; 3'UTR length: 656; Forward Primer: TGGAGCCATGAGGGCTGA; Reverse Primer: CCCTGAACTAGGCTTCCAGTTACTTCA NM_001242701 No/No NA P2RP3 bacterial:kanamycin
43 HsCD00730133 Plasmid Details cDNA FABP6 fatty acid binding protein 6, ileal NA BC022489 No/No FUSION pANT7_cGST bacterial:ampicillin
44 HsCD00730576 Plasmid Details cDNA BAAT bile acid CoA:amino acid N-acyltransferase NA NM_001701 No/No FUSION pANT7_cGST bacterial:ampicillin
45 HsCD00730812 Plasmid Details cDNA BAAT bile acid CoA:amino acid N-acyltransferase NA BC009567 No/No FUSION pANT7_cGST bacterial:ampicillin
46 HsCD00731115 Plasmid Details cDNA ALB albumin NA BC034023 No/No FUSION pANT7_cGST bacterial:ampicillin
47 HsCD00731636 Plasmid Details cDNA SLC27A5 solute carrier family 27 (fatty acid transporter), member 5 NA NM_012254 No/No FUSION pANT7_cGST bacterial:ampicillin
48 HsCD00784968 Plasmid Details cDNA FABP6 fatty acid binding protein 6 NA NM_001040442 Yes/No FUSION pANT7_cGST bacterial:ampicillin
49 HsCD00813263 Plasmid Details cDNA FABP6 fatty acid binding protein 6 Gene synthesis by Gen9. Codon optimized NM_001040442 No/No FUSION pDONR221 bacterial:kanamycin
50 HsCD00817746 Plasmid Details cDNA ALB albumin "insert_ID 26967,DNASU_Clone_ID HsCD00040274" BC034023 No/No FUSION pJFT7_nHalo_DC(r4) bacterial:ampicillin
No of Result Per Page : Page: