DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Ascorbate degradation, 14 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00022425 Plasmid Details cDNA XYLB xylulokinase homolog (H. influenzae) NA NM_005108 No/Yes FUSION pDNR-Dual bacterial:ampicillin
2 HsCD00038548 Plasmid Details cDNA XYLB xylulokinase homolog (H. influenzae) NA NM_005108 No/Yes FUSION pJP1520 mammalian:puromycin
3 HsCD00039000 Plasmid Details cDNA XYLB xylulokinase homolog (H. influenzae) NA NM_005108 No/Yes FUSION pJP1563 mammalian:blasticidin
4 HsCD00296014 Plasmid Details cDNA RPE ribulose-5-phosphate-3-epimerase NA BC005148.2 No/No CLOSED pDONR221 bacterial:kanamycin
5 HsCD00296185 Plasmid Details cDNA RPE ribulose-5-phosphate-3-epimerase NA BC005148.2 No/No FUSION pDONR221 bacterial:kanamycin
6 HsCD00326041 Plasmid Details cDNA RPE HGNC: 10293| MIM: 180480| Ensembl: ENSG00000197713| HPRD: 01608 NA No/No FUSION pSpeedET bacterial:kanamycin
7 HsCD00397594 Plasmid Details cDNA RPE ribulose-5-phosphate-3-epimerase full-length cds NM_199229 No/No CLOSED pVP56K bacterial:kanamycin
8 HsCD00429554 Plasmid Details cDNA RPE ribulose-5-phosphate-3-epimerase full-length cds NM_199229 No/No CLOSED pVP16 bacterial:ampicillin
9 HsCD00437945 Plasmid Details cDNA RPE ribulose-5-phosphate-3-epimerase NA EU832009 No/No FUSION pLX304 mammalian:blasticidin
10 HsCD00507591 Plasmid Details cDNA RPE ribulose-5-phosphate-3-epimerase NA EU832009 No/No FUSION pENTR223 bacterial:spectinomycin
11 HsCD00618312 Plasmid Details cDNA XYLB xylulokinase homolog (H. influenzae) NA NM_005108 No/No CLOSED pLDNT7_nFLAG bacterial:chloramphenicol
12 HsUT00698711 Plasmid Details 3'UTR TCF7 transcription factor 7 (T-cell specific, HMG-box) Sequence Verified: Yes; 3'UTR length: 2205; Forward Primer: ACTATGAATTCACCCTCTGTTTACAGATAA; Reverse Primer: AGGGGAGATGACAAGTGTAATCCCT NM_201634 No/No NA P2RP3 bacterial:kanamycin
13 HsCD00734592 Plasmid Details cDNA RPE ribulose-5-phosphate-3-epimerase NA NM_199229 No/No FUSION pANT7_cGST bacterial:ampicillin
14 HsCD00745820 Plasmid Details cDNA XYLB xylulokinase homolog (H. influenzae) NA NM_005108 No/No FUSION pDONR221 bacterial:kanamycin
No of Result Per Page : Page: