DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Bile salt and organic anion SLC transporters, 42 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00039726 Plasmid Details cDNA SLC13A4 solute carrier family 13 (sodium/sulfate symporters), member 4 NA BC030689 No/No FUSION pDONR221 bacterial:kanamycin
2 HsCD00040532 Plasmid Details cDNA SLC16A7 solute carrier family 16, member 7 (monocarboxylic acid transporter 2) NA BC030693 No/No FUSION pDONR221 bacterial:kanamycin
3 HsCD00041048 Plasmid Details cDNA SLC16A1 solute carrier family 16, member 1 (monocarboxylic acid transporter 1) NA BC026317 No/No FUSION pDONR221 bacterial:kanamycin
4 HsCD00041633 Plasmid Details cDNA SLC13A3 solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3 NA BC035966 No/No FUSION pDONR221 bacterial:kanamycin
5 HsCD00044707 Plasmid Details cDNA SLC13A3 solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3 NA BC035966 No/No CLOSED pDONR221 bacterial:kanamycin
6 HsCD00045575 Plasmid Details cDNA SLC13A4 solute carrier family 13 (sodium/sulfate symporters), member 4 NA BC030689 No/No CLOSED pDONR221 bacterial:kanamycin
7 HsCD00045596 Plasmid Details cDNA SLC16A7 solute carrier family 16, member 7 (monocarboxylic acid transporter 2) NA BC030693 No/No CLOSED pDONR221 bacterial:kanamycin
8 HsCD00076173 Plasmid Details cDNA SLC16A1 solute carrier family 16 (monocarboxylic acid transporters), member 1 NA BC026317 No/No CLOSED pDONR221 bacterial:kanamycin
9 HsCD00076867 Plasmid Details cDNA SLC13A4 solute carrier family 13 (sodium/sulfate symporters), member 4 NA BC030689 No/No FUSION pANT7_cGST bacterial:ampicillin
10 HsCD00078427 Plasmid Details cDNA SLC16A1 solute carrier family 16, member 1 (monocarboxylic acid transporter 1) NA BC026317 No/No FUSION pANT7_cGST bacterial:ampicillin
11 HsCD00080191 Plasmid Details cDNA SLC13A1 solute carrier family 13 (sodium/sulfate symporters), member 1 NA NM_022444 No/No CLOSED pENTR223.1 bacterial:spectinomycin
12 HsCD00081256 Plasmid Details cDNA SLC13A1 solute carrier family 13 (sodium/sulfate symporters), member 1 NA NM_022444 No/No FUSION pENTR223.1 bacterial:spectinomycin
13 HsCD00082902 Plasmid Details cDNA SLC16A8 solute carrier 16 (monocarboxylic acid transporters), member 8 NA NM_013356 No/No FUSION pENTR223.1 bacterial:spectinomycin
14 HsCD00296009 Plasmid Details cDNA SLC16A1 solute carrier family 16, member 1 (monocarboxylic acid transporter 1) NA AL162079.1 No/No CLOSED pDONR221 bacterial:kanamycin
15 HsCD00296180 Plasmid Details cDNA SLC16A1 solute carrier family 16, member 1 (monocarboxylic acid transporter 1) NA AL162079.1 No/Yes FUSION pDONR221 bacterial:kanamycin
16 HsCD00350692 Plasmid Details cDNA SLC16A8 solute carrier family 16, member 8 (monocarboxylic acid transporter 3) NA BC156246 No/No FUSION pENTR223.1 bacterial:spectinomycin
17 HsCD00398730 Plasmid Details cDNA SLC16A3 solute carrier family 16, member 3 (monocarboxylic acid transporter 4) NA HQ258434 No/No FUSION pDONR223 bacterial:spectinomycin
18 HsCD00403039 Plasmid Details cDNA SLC16A8 solute carrier family 16, member 8 (monocarboxylic acid transporter 3) NA BC156246 No/No FUSION pANT7_cGST bacterial:ampicillin
19 HsCD00403807 Plasmid Details cDNA SLC16A3 solute carrier family 16, member 3 (monocarboxylic acid transporter 4) NA HQ258434 No/No FUSION pANT7_cGST bacterial:ampicillin
20 HsCD00436001 Plasmid Details cDNA SLC47A1 solute carrier family 47, member 1 NA No/No FUSION pLX304 mammalian:blasticidin
21 HsCD00441632 Plasmid Details cDNA SLC16A7 solute carrier family 16, member 7 (monocarboxylic acid transporter 2) NA No/Yes FUSION pLX304 mammalian:blasticidin
22 HsCD00442487 Plasmid Details cDNA SLC13A4 solute carrier family 13 (sodium/sulfate symporters), member 4 NA No/Yes FUSION pLX304 mammalian:blasticidin
23 HsCD00442532 Plasmid Details cDNA SLC47A1 solute carrier family 47, member 1 NA No/No FUSION pLX304 mammalian:blasticidin
24 HsCD00443530 Plasmid Details cDNA SLC13A2 solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2 NA No/No FUSION pLX304 mammalian:blasticidin
25 HsCD00446789 Plasmid Details cDNA SLC10A6 solute carrier family 10 (sodium/bile acid cotransporter family), member 6 NA No/No FUSION pLX304 mammalian:blasticidin
26 HsCD00510487 Plasmid Details cDNA SLC47A1 solute carrier family 47, member 1 NA No/No FUSION pENTR223 bacterial:spectinomycin
27 HsCD00510943 Plasmid Details cDNA SLC10A6 solute carrier family 10 (sodium/bile acid cotransporter family), member 6 NA No/No FUSION pENTR223 bacterial:spectinomycin
28 HsCD00513438 Plasmid Details cDNA SLC47A1 solute carrier family 47, member 1 NA No/No FUSION pENTR223 bacterial:spectinomycin
29 HsCD00514106 Plasmid Details cDNA SLC13A2 solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2 NA No/No FUSION pENTR223 bacterial:spectinomycin
30 HsCD00515788 Plasmid Details cDNA SLC13A2 solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2 NA No/No FUSION pENTR223 bacterial:spectinomycin
31 HsCD00516166 Plasmid Details cDNA SLC13A5 solute carrier family 13 (sodium-dependent citrate transporter), member 5 NA No/No FUSION pENTR223 bacterial:spectinomycin
32 HsCD00583098 Plasmid Details cDNA SLC10A6 solute carrier family 10 (sodium/bile acid cotransporter family), member 6 NA No/No FUSION pPICZa bacterial:zeocin
33 HsCD00627281 Plasmid Details cDNA SLC13A4 solute carrier family 13 (sodium/sulfate symporter), member 4 NA No/No FUSION pPICZa bacterial:zeocin
34 HsCD00627295 Plasmid Details cDNA SLC13A1 solute carrier family 13 (sodium/sulfate symporter), member 1 codon-optimized sequence No/Yes CLOSED pPICZa bacterial:zeocin
35 HsCD00629562 Plasmid Details cDNA SLC47A1 solute carrier family 47 (multidrug and toxin extrusion), member 1 NA No/No FUSION pANT7_cGST bacterial:ampicillin
36 HsCD00630776 Plasmid Details cDNA SLC13A5 solute carrier family 13 (sodium-dependent citrate transporter), member 5 NA No/No FUSION pANT7_cGST bacterial:ampicillin
37 HsCD00630809 Plasmid Details cDNA SLC10A6 solute carrier family 10 (sodium/bile acid cotransporter), member 6 NA No/No FUSION pANT7_cGST bacterial:ampicillin
38 HsCD00631217 Plasmid Details cDNA SLC13A2 solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2 NA No/No FUSION pANT7_cGST bacterial:ampicillin
39 HsUT00699261 Plasmid Details 3'UTR TRIP13 thyroid hormone receptor interactor 13 Sequence Verified: Yes; 3'UTR length: 1126; Forward Primer: AAGAAGCTTGCAGCTTACATCTGA; Reverse Primer: GGCCACTGGCACCTTCCC NM_004237 No/No NA P2RP3 bacterial:kanamycin
40 HsCD00730941 Plasmid Details cDNA SLC13A3 solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3 NA BC035966 No/No FUSION pANT7_cGST bacterial:ampicillin
41 HsCD00731063 Plasmid Details cDNA SLC16A7 solute carrier family 16 (monocarboxylate transporter), member 7 NA BC030693 No/No FUSION pANT7_cGST bacterial:ampicillin
42 HsCD00731691 Plasmid Details cDNA SLC16A8 solute carrier family 16 (monocarboxylate transporter), member 8 NA NM_013356 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: