DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : APOBEC3G mediated resistance to HIV-1 infection, 41 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00000034 Plasmid Details cDNA PSIP1 NA NA NM_021144 No/Yes CLOSED pDONR201 bacterial:kanamycin
2 HsCD00000035 Plasmid Details cDNA PSIP1 NA NA NM_021144 No/Yes CLOSED pDNR-Dual bacterial:ampicillin
3 HsCD00000094 Plasmid Details cDNA HMGA1 high mobility group AT-hook 1 NA NM_002131 No/No FUSION pDONR201 bacterial:kanamycin
4 HsCD00000095 Plasmid Details cDNA HMGA1 high mobility group AT-hook 1 NA NM_002131 No/No CLOSED pDONR201 bacterial:kanamycin
5 HsCD00000096 Plasmid Details cDNA HMGA1 high mobility group AT-hook 1 NA NM_002131 No/No FUSION pDNR-Dual bacterial:ampicillin
6 HsCD00000097 Plasmid Details cDNA HMGA1 high mobility group AT-hook 1 NA NM_002131 No/No CLOSED pDNR-Dual bacterial:ampicillin
7 HsCD00003374 Plasmid Details cDNA HMGA1 high mobility group AT-hook 1 NA BC004924 No/No FUSION pDNR-Dual bacterial:ampicillin
8 HsCD00003375 Plasmid Details cDNA HMGA1 high mobility group AT-hook 1 NA BC004924 No/No FUSION pDNR-Dual bacterial:ampicillin
9 HsCD00003376 Plasmid Details cDNA HMGA1 high mobility group AT-hook 1 NA BC004924 No/No CLOSED pDNR-Dual bacterial:ampicillin
10 HsCD00041604 Plasmid Details cDNA PPIA peptidylprolyl isomerase A (cyclophilin A) NA BC000689 No/No FUSION pDONR221 bacterial:kanamycin
11 HsCD00044677 Plasmid Details cDNA PPIA peptidylprolyl isomerase A (cyclophilin A) NA BC000689 No/No CLOSED pDONR221 bacterial:kanamycin
12 HsCD00045132 Plasmid Details cDNA HMGA1 high mobility group AT-hook 1 NA BC008832 No/No CLOSED pDONR221 bacterial:kanamycin
13 HsCD00073937 Plasmid Details cDNA APOBEC3G apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G NA CR456472 No/No FUSION pENTR223 bacterial:spectinomycin
14 HsCD00074031 Plasmid Details cDNA APOBEC3G apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G NA CR456472 No/No CLOSED pENTR223 bacterial:spectinomycin
15 HsCD00074791 Plasmid Details cDNA HMGA1 high mobility group AT-hook 1 NA NM_002131 No/No CLOSED pJP1520 mammalian:puromycin
16 HsCD00075515 Plasmid Details cDNA HMGA1 high mobility group AT-hook 1 NA BC004924 No/No CLOSED pJP1520 mammalian:puromycin
17 HsCD00076271 Plasmid Details cDNA HMGA1 high mobility group AT-hook 1 NA BC008832 No/No FUSION pDONR221 bacterial:kanamycin
18 HsCD00330178 Plasmid Details cDNA HMGA1 high mobility group AT-hook 1 NA NM_002131 No/No FUSION pLenti6.2/V5-DEST mammalian:blasticidin
19 HsCD00330236 Plasmid Details cDNA HMGA1 high mobility group AT-hook 1 NA BC008832 No/No FUSION pLenti6.2/V5-DEST mammalian:blasticidin
20 HsCD00350838 Plasmid Details cDNA APOBEC3G apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G NA CU013022 No/No CLOSED pENTR223 bacterial:spectinomycin
21 HsCD00351222 Plasmid Details cDNA APOBEC3G apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G NA CU013310 No/No FUSION pENTR223 bacterial:spectinomycin
22 HsCD00402601 Plasmid Details cDNA APOBEC3G apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G NA CU013310 No/No FUSION pANT7_cGST bacterial:ampicillin
23 HsCD00434362 Plasmid Details cDNA PPIA peptidylprolyl isomerase A (cyclophilin A) NA DQ895865 No/No FUSION pLX304 mammalian:blasticidin
24 HsCD00437633 Plasmid Details cDNA BANF1 barrier to autointegration factor 1 NA No/No FUSION pLX304 mammalian:blasticidin
25 HsCD00437672 Plasmid Details cDNA HMGA1 high mobility group AT-hook 1 NA EU176767 No/No FUSION pLX304 mammalian:blasticidin
26 HsCD00440883 Plasmid Details cDNA HMGA1 high mobility group AT-hook 1 NA EU176767 No/No FUSION pLX304 mammalian:blasticidin
27 HsCD00440961 Plasmid Details cDNA PPIA peptidylprolyl isomerase A (cyclophilin A) NA DQ895865 No/No FUSION pLX304 mammalian:blasticidin
28 HsCD00445920 Plasmid Details cDNA APOBEC3G apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G NA CU013310 No/No FUSION pLX304 mammalian:blasticidin
29 HsCD00504503 Plasmid Details cDNA BANF1 barrier to autointegration factor 1 NA No/No FUSION pENTR223 bacterial:spectinomycin
30 HsCD00504587 Plasmid Details cDNA HMGA1 high mobility group AT-hook 1 NA EU176767 No/No FUSION pENTR223 bacterial:spectinomycin
31 HsCD00504725 Plasmid Details cDNA HMGA1 high mobility group AT-hook 1 NA EU176767 No/No FUSION pENTR223 bacterial:spectinomycin
32 HsCD00506343 Plasmid Details cDNA PPIA peptidylprolyl isomerase A (cyclophilin A) NA DQ895865 No/No FUSION pENTR223 bacterial:spectinomycin
33 HsCD00506397 Plasmid Details cDNA PPIA peptidylprolyl isomerase A (cyclophilin A) NA DQ895865 No/No FUSION pENTR223 bacterial:spectinomycin
34 HsCD00511029 Plasmid Details cDNA APOBEC3G apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G NA CU013310 No/No FUSION pENTR223 bacterial:spectinomycin
35 HsCD00583770 Plasmid Details cDNA PSIP1 PC4 and SFRS1 interacting protein 1 targeted domain No/No CLOSED pET15_NESG bacterial:ampicillin
36 HsCD00630720 Plasmid Details cDNA HMGA1 high mobility group AT-hook 1 NA No/No FUSION pANT7_cGST bacterial:ampicillin
37 HsCD00630833 Plasmid Details cDNA BANF1 barrier to autointegration factor 1 NA No/No FUSION pANT7_cGST bacterial:ampicillin
38 HsUT00699294 Plasmid Details 3'UTR NHEJ1 nonhomologous end-joining factor 1 Sequence Verified: Yes; 3'UTR length: 1237; Forward Primer: AAGCCAAGGGGTCTCTTCAGTTAA; Reverse Primer: GACCTTTGATAAGTCACTTACTCACTTCAG NM_024782 No/No NA P2RP3 bacterial:kanamycin
39 HsCD00730189 Plasmid Details cDNA HMGA1 high mobility group AT-hook 1 NA NM_002131 No/No FUSION pANT7_cGST bacterial:ampicillin
40 HsCD00730944 Plasmid Details cDNA PPIA peptidylprolyl isomerase A (cyclophilin A) NA BC000689 No/No FUSION pANT7_cGST bacterial:ampicillin
41 HsCD00817214 Plasmid Details cDNA PPIA peptidylprolyl isomerase A "insert_ID 28297,DNASU_Clone_ID HsCD00041604" BC000689 No/No FUSION pJFT7_nHalo_DC(r4) bacterial:ampicillin
No of Result Per Page : Page: