DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : ATP sensitive Potassium channels, 10 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00002854 Plasmid Details cDNA KCNJ8 potassium inwardly-rectifying channel, subfamily J, member 8 NA BC000544 No/No FUSION pDNR-Dual bacterial:ampicillin
2 HsCD00040859 Plasmid Details cDNA KCNJ8 potassium inwardly-rectifying channel, subfamily J, member 8 NA BC000544 No/No FUSION pDONR221 bacterial:kanamycin
3 HsCD00043986 Plasmid Details cDNA KCNJ8 potassium inwardly-rectifying channel, subfamily J, member 8 NA BC000544 No/No CLOSED pDONR221 bacterial:kanamycin
4 HsCD00295126 Plasmid Details cDNA ABCC8 ATP-binding cassette, sub-family C (CFTR/MRP), member 8 NA NM_000352.3 No/No CLOSED pENTR223.1 bacterial:spectinomycin
5 HsCD00443403 Plasmid Details cDNA KCNJ11 potassium inwardly-rectifying channel, subfamily J, member 11 NA No/No FUSION pLX304 mammalian:blasticidin
6 HsCD00511768 Plasmid Details cDNA KCNJ11 potassium inwardly-rectifying channel, subfamily J, member 11 NA No/No FUSION pENTR223 bacterial:spectinomycin
7 HsCD00631159 Plasmid Details cDNA KCNJ11 potassium inwardly-rectifying channel, subfamily J, member 11 NA No/No FUSION pANT7_cGST bacterial:ampicillin
8 HsUT00698881 Plasmid Details 3'UTR GNAI2 guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 Sequence Verified: Yes; 3'UTR length: 1844; Forward Primer: GGACTGCGGCCTCTTCTG; Reverse Primer: TGAAGCTCAGAGCGTGGG NM_002070 No/No NA P2RP3 bacterial:kanamycin
9 HsUT00699440 Plasmid Details 3'UTR NCOA1 nuclear receptor coactivator 1 Sequence Verified: Yes; 3'UTR length: 2490; Forward Primer: CTTCAGCAGCTACTGACTGAATAA; Reverse Primer: ATCTTCTGAGTCAAGAAACAGCAGG NM_003743 No/No NA P2RP3 bacterial:kanamycin
10 HsCD00734290 Plasmid Details cDNA KCNJ8 potassium channel, inwardly rectifying subfamily J, member 8 NA BC000544 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: