DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results


Pathway : Abacavir transport and metabolism, 54 clones found

No of Result Per Page : Page: Explanation of Terms
Plasmid ID
Keywords Reference
Vector Selection
1 HsCD00000651 Plasmid Details cDNA GUK1 guanylate kinase 1 NA NM_000858 No/No FUSION pDNR-Dual bacterial:ampicillin
2 HsCD00000652 Plasmid Details cDNA GUK1 guanylate kinase 1 NA NM_000858 No/No FUSION pDNR-Dual bacterial:ampicillin
3 HsCD00001026 Plasmid Details cDNA ADH1A alcohol dehydrogenase 1A (class I), alpha polypeptide NA NM_000667 No/No CLOSED pDNR-Dual bacterial:ampicillin
4 HsCD00004474 Plasmid Details cDNA GUK1 guanylate kinase 1 NA BC009914 No/No FUSION pDNR-Dual bacterial:ampicillin
5 HsCD00005391 Plasmid Details cDNA GUK1 guanylate kinase 1 NA U66895 No/No FUSION pDONR201 bacterial:kanamycin
6 HsCD00005760 Plasmid Details cDNA ABCG2 ATP-binding cassette, sub-family G (WHITE), member 2 NA BC021281 No/No CLOSED pDNR-Dual bacterial:ampicillin
7 HsCD00005778 Plasmid Details cDNA PCK1 phosphoenolpyruvate carboxykinase 1 (soluble) NA BC023978 No/No FUSION pDNR-Dual bacterial:ampicillin
8 HsCD00037960 Plasmid Details cDNA GUK1 guanylate kinase 1 NA BC009914 No/No FUSION pJP1520 mammalian:puromycin
9 HsCD00038196 Plasmid Details cDNA PCK1 phosphoenolpyruvate carboxykinase 1 (soluble) NA BC023978 No/No FUSION pJP1520 mammalian:puromycin
10 HsCD00038239 Plasmid Details cDNA GUK1 guanylate kinase 1 NA NM_000858 No/No FUSION pJP1520 mammalian:puromycin
11 HsCD00038403 Plasmid Details cDNA GUK1 guanylate kinase 1 NA NM_000858 No/No FUSION pJP1563 mammalian:blasticidin
12 HsCD00038969 Plasmid Details cDNA PCK1 phosphoenolpyruvate carboxykinase 1 (soluble) NA BC023978 No/No FUSION pJP1563 mammalian:blasticidin
13 HsCD00039112 Plasmid Details cDNA GUK1 guanylate kinase 1 NA BC009914 No/No FUSION pJP1563 mammalian:blasticidin
14 HsCD00041257 Plasmid Details cDNA ABCG2 ATP-binding cassette, sub-family G (WHITE), member 2 NA BC021281 No/No FUSION pDONR221 bacterial:kanamycin
15 HsCD00041488 Plasmid Details cDNA NT5C2 5'-nucleotidase, cytosolic II NA BC001595 No/No FUSION pDONR221 bacterial:kanamycin
16 HsCD00042194 Plasmid Details cDNA PCK1 phosphoenolpyruvate carboxykinase 1 (soluble) NA BC023978 No/No FUSION pDONR221 bacterial:kanamycin
17 HsCD00044371 Plasmid Details cDNA ABCG2 ATP-binding cassette, sub-family G (WHITE), member 2 NA BC021281 No/No CLOSED pDONR221 bacterial:kanamycin
18 HsCD00044589 Plasmid Details cDNA NT5C2 5'-nucleotidase, cytosolic II NA BC001595 No/No CLOSED pDONR221 bacterial:kanamycin
19 HsCD00045535 Plasmid Details cDNA PCK1 phosphoenolpyruvate carboxykinase 1 (soluble) NA BC023978 No/No CLOSED pDONR221 bacterial:kanamycin
20 HsCD00074341 Plasmid Details cDNA ABCG2 ATP-binding cassette, sub-family G (WHITE), member 2 NA BC021281 No/No CLOSED pJP1520 mammalian:puromycin
21 HsCD00082414 Plasmid Details cDNA ABCB1 ATP-binding cassette, sub-family B (MDR/TAP), member 1 NA NM_000927 No/Yes FUSION pDONR201 bacterial:kanamycin
22 HsCD00083722 Plasmid Details cDNA NT5C2 5'-nucleotidase, cytosolic II NA BC001595 No/No CLOSED pVP16 bacterial:ampicillin
23 HsCD00084118 Plasmid Details cDNA FLJ44620 similar to CG11994-PA NA BC075857 No/No CLOSED pVP16 bacterial:ampicillin
24 HsCD00301003 Plasmid Details cDNA PCK1 phosphoenolpyruvate carboxykinase 1 (soluble) NA BC023978 No/No FUSION pLDNT7_nFLAG bacterial:ampicillin
25 HsCD00301495 Plasmid Details cDNA GUK1 guanylate kinase 1 NA U66895 No/No FUSION pANT7_cGST bacterial:ampicillin
26 HsCD00313234 Plasmid Details cDNA ADAL adenosine deaminase-like full-length cds BC075857 No/No CLOSED pDONR221 bacterial:kanamycin
27 HsCD00398461 Plasmid Details cDNA SLC22A1 solute carrier family 22 (organic cation transporter), member 1 NA HQ258293 No/No FUSION pDONR223 bacterial:spectinomycin
28 HsCD00404006 Plasmid Details cDNA SLC22A1 solute carrier family 22 (organic cation transporter), member 1 NA HQ258293 No/No FUSION pANT7_cGST bacterial:ampicillin
29 HsCD00440156 Plasmid Details cDNA ADH1A alcohol dehydrogenase 1A (class I), alpha polypeptide NA No/No FUSION pLX304 mammalian:blasticidin
30 HsCD00442957 Plasmid Details cDNA SLC22A2 solute carrier family 22 (organic cation transporter), member 2 NA No/No FUSION pLX304 mammalian:blasticidin
31 HsCD00446071 Plasmid Details cDNA ADAL adenosine deaminase-like NA No/Yes FUSION pLX304 mammalian:blasticidin
32 HsCD00446595 Plasmid Details cDNA SLC22A1 solute carrier family 22 (organic cation transporter), member 1 NA HQ258293 No/No FUSION pLX304 mammalian:blasticidin
33 HsCD00513368 Plasmid Details cDNA SLC22A1 solute carrier family 22 (organic cation transporter), member 1 NA HQ258293 No/No FUSION pENTR223 bacterial:spectinomycin
34 HsCD00513846 Plasmid Details cDNA SLC22A2 solute carrier family 22 (organic cation transporter), member 2 NA No/No FUSION pENTR223 bacterial:spectinomycin
35 HsCD00514933 Plasmid Details cDNA GUK1 guanylate kinase 1 NA No/No FUSION pENTR223 bacterial:spectinomycin
36 HsCD00546191 Plasmid Details cDNA NT5C2 5'-nucleotidase, cytosolic II NA BC001595 No/No CLOSED pSpeedET bacterial:kanamycin
37 HsCD00546367 Plasmid Details cDNA NT5C2 5'-nucleotidase, cytosolic II full-length cds BC001595 No/No CLOSED pDONR221 bacterial:kanamycin
38 HsCD00583114 Plasmid Details cDNA SLC22A1 solute carrier family 22 (organic cation transporter), member 1 NA No/No FUSION pPICZa bacterial:zeocin
39 HsCD00616403 Plasmid Details cDNA NT5C2 5'-nucleotidase, cytosolic II NA BC001595 No/No FUSION pANT7_cGST bacterial:ampicillin
40 HsCD00618007 Plasmid Details cDNA GUK1 guanylate kinase 1 NA BC009914 No/No CLOSED pLDNT7_nFLAG bacterial:chloramphenicol
41 HsCD00622803 Plasmid Details cDNA ADH1A "alcohol dehydrogenase 1A (class I), alpha polypeptide" PERFECT_MATCH BC126306.1 No/No FUSION pENTR223 bacterial:spectinomycin
42 HsCD00627272 Plasmid Details cDNA ABCG2 ATP-binding cassette, sub-family G (WHITE), member 2 NA No/No FUSION pPICZa bacterial:zeocin
43 HsCD00627294 Plasmid Details cDNA SLC22A2 solute carrier family 22 (organic cation transporter), member 2 codon-optimized sequence No/Yes CLOSED pPICZa bacterial:zeocin
44 HsCD00639140 Plasmid Details cDNA SLC22A2 solute carrier family 22 (organic cation transporter), member 2 NA No/No FUSION pANT7_cGST bacterial:ampicillin
45 HsUT00699386 Plasmid Details 3'UTR ZNF860 zinc finger protein 860 Sequence Verified: Yes; 3'UTR length: 938; Forward Primer: AAGCGTGGCAAGGTCTTCAGTTAG; Reverse Primer: GCACCTGGCATTTTTTTTTTTTTAGCCT NM_001137674 No/No NA P2RP3 bacterial:kanamycin
46 HsCD00716987 Plasmid Details cDNA ADH1A alcohol dehydrogenase 1A (class I), alpha polypeptide NA BC126306 No/No FUSION pANT7_cGST bacterial:ampicillin
47 HsCD00718607 Plasmid Details cDNA ADH1A alcohol dehydrogenase 1A (class I), alpha polypeptide NA BC126306 No/No FUSION pDONR221 bacterial:kanamycin
48 HsCD00732500 Plasmid Details cDNA PCK1 phosphoenolpyruvate carboxykinase 1 (soluble) NA BC023978 No/No FUSION pANT7_cGST bacterial:ampicillin
49 HsCD00734294 Plasmid Details cDNA ABCG2 ATP-binding cassette, sub-family G (WHITE), member 2 (Junior blood group) NA BC021281 No/No FUSION pANT7_cGST bacterial:ampicillin
50 HsCD00734805 Plasmid Details cDNA ADH1A alcohol dehydrogenase 1A (class I), alpha polypeptide NA BC126306 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: