DNASU Plasmid Repository • 480.965.5697 | Email

Sequencing Primers

TOP

DNASU uses various primers to sequence verify gene inserts for most of the plasmids avialable in the repository. Below is a list of all vectors in DNASU along with the forward and reverse primer names and sequences for sequencing the insert. Fo a list of just primers and their sequences, visit our Primer page.

If you are interested in Sanger or Next Generation sequencing Services, please refer to our Sequencing Core website for more information.

Vector Name Forward Primer Sequence Reverse Primer Sequence
p11 T7p AATTAATACGACTCACTATAGGG T7t ATGCTAGTTATTGCTCAGCGG
p15Tv-LIC T7p AATTAATACGACTCACTATAGGG T7t ATGCTAGTTATTGCTCAGCGG
p283 T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
p4-Hb Phsp  AGGTGACCACAACGACGC
p4-Ib p4 GGTTTAAACGGATCCAGC
p4-Sb p4 GGTTTAAACGGATCCAGC
p9T-c PtetO GGATCGTCGGCACCGTCA
p9T-H Phsp  AGGTGACCACAACGACGC
p9T-I PtetO GGATCGTCGGCACCGTCA
p9T-S PtetO GGATCGTCGGCACCGTCA
pANT7_cGST NAP150 CCCATTGTATGGGATCTGATC NAP138R TGTTTCGCCATTTATCACCTTC
pANT7_nHA NAP150 CCCATTGTATGGGATCTGATC NAP138R TGTTTCGCCATTTATCACCTTC
pBABEneo pBABE 5’ CTTTATCCAGCCCTCAC pBABE 3’ ACCCTAACTGACACACATTCC
pBABEpuro pBABE 5’ CTTTATCCAGCCCTCAC pBABE 3’ ACCCTAACTGACACACATTCC
pBAD24sigCtermHis PBADFOR GCACGGCGTCACACTTTGC RRNBTER TCTGCGTTCTGATTTAATCTGTATCA
pBAD24sigNtermHis PBADFOR GCACGGCGTCACACTTTGC RRNBTER TCTGCGTTCTGATTTAATCTGTATCA
pBL166 pFAB007 GGACGCATCGTGGCCC
pBLUNT pBAD forward ATGCCATAGCATTTTTATCC alt_bad_rev GGGTCAGGTGGGACCAC
pBY011 M13F GTAAAACGACGGCCAGT M13R CAGGAAACAGCTATGACC
pBY011_GFP-NH3_CN M13F GTAAAACGACGGCCAGT M13R CAGGAAACAGCTATGACC
PCDF Bravo T7 TAATACGACTCACTATAGGG T7 terminator GCTAGTTATTGCTCAGCGG
pCDF-BAD ARAC5R GGGATCATTTTGCGCTTCAG T7 terminator GCTAGTTATTGCTCAGCGG
pCMVi-LSrCOMPTT TTFOR CAACAACTTCACCGTGAGC HGHTER ACTGGAGTGGCAACTTCCAGG
pCMVi-LS LSFOR TTCTGTCTCGTGGGGCAT HGHTER ACTGGAGTGGCAACTTCCAGG
pCMVi-UB UBFOR AACATCCAGAAGGAGTCA HGHTER ACTGGAGTGGCAACTTCCAGG
pcDNA3(+) T7 TAATACGACTCACTATAG M13R CAGGAAACAGCTATGACC
pcDNA3.1zeo T7 TAATACGACTCACTATAG M13R CAGGAAACAGCTATGACC
pCMV(delta1) pcDNAF AGAGAACCCACTGCTTACTGGCTTATC pcDNAR AACTAGAAGGCACAGTCGAGGCTG
pCMV(delta2) pcDNAF AGAGAACCCACTGCTTACTGGCTTATC pcDNAR AACTAGAAGGCACAGTCGAGGCTG
pCMV(delta3) pcDNAF AGAGAACCCACTGCTTACTGGCTTATC pcDNAR AACTAGAAGGCACAGTCGAGGCTG
pCMV(delta4) pcDNAF AGAGAACCCACTGCTTACTGGCTTATC pcDNAR AACTAGAAGGCACAGTCGAGGCTG
pCMV(delta5) pcDNAF AGAGAACCCACTGCTTACTGGCTTATC pcDNAR AACTAGAAGGCACAGTCGAGGCTG
pCMV(delta6) pcDNAF AGAGAACCCACTGCTTACTGGCTTATC pcDNAR AACTAGAAGGCACAGTCGAGGCTG
pCMV(WT) pcDNAF AGAGAACCCACTGCTTACTGGCTTATC pcDNAR AACTAGAAGGCACAGTCGAGGCTG
pCPD_nGST-SBP_DC pCPD5698_F AATTCATGGACGAGAAGACC pCPD6268_R AGCCAACTCAGCTTCCTTT
pCPD_nHalo_cHIS_DC HaloseqF AAGCCTGCCTAACTGCAA            pCPD6268_R       AGCCAACTCAGCTTCCTTT                                         
pCPD_nHalo_DC HaloseqF AAGCCTGCCTAACTGCAA            pCPD6268_R       AGCCAACTCAGCTTCCTTT                                         
pCPD_nMBP-SBP_DC  pCPD5698_F AATTCATGGACGAGAAGACC pCPD6268_R AGCCAACTCAGCTTCCTTT
pCPD_nSBP-Halo_DC pCPD5698_F AATTCATGGACGAGAAGACC pCPD6268_R AGCCAACTCAGCTTCCTTT
pCR4 M13F GTAAAACGACGGCCAGT M13R CAGGAAACAGCTATGACC
pCR4zeroBLUNT-TOPO M13F GTAAAACGACGGCCAGT M13R CAGGAAACAGCTATGACC
pCW-FABAVI-LIC pFAB007 GGACGCATCGTGGCCC
pDB.GST T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pDB.HBP TEV GAAAACCTGTACTTCCAG
pDB.His.MBP T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pDB.His.NusA T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pDB.His.TRX T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pDB.TRX T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pDB-HisGST T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pDEST17 T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pDNR-Dual M13F GTAAAACGACGGCCAGT
pDONR201 pDONR201-forward GTAACATCAGAGATTTTGAGACAC pDONR201-reverse TCGCGTTAACGCTAGCATGGATCTC
pDONR221 U19 GTTTTCCCAGTCACGACGT AttP2 CAGGAAACAGCTATGAC
pDONR223 M13F GTAAAACGACGGCCAGT M13R CAGGAAACAGCTATGACC
pEMB54 pBAD forward ATGCCATAGCATTTTTATCC pBADrev TAGTTATTGCTCAGCGGTGG
pENTR/D-TOPO M13F GTAAAACGACGGCCAGT M13R CAGGAAACAGCTATGACC
pENTR201 pDONR201-forward GTAACATCAGAGATTTTGAGACAC pDONR201-reverse TCGCGTTAACGCTAGCATGGATCTC
pENTR221 M13F GTAAAACGACGGCCAGT M13R CAGGAAACAGCTATGACC
pENTR223 M13F GTAAAACGACGGCCAGT M13R CAGGAAACAGCTATGACC
pENTR223.1 M13F GTAAAACGACGGCCAGT M13R CAGGAAACAGCTATGACC
pET15Avi8HMbpTEV_NESG T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pET15Avi8HSumoTEV_NESG MBPSeq Forward TCGTCAGACTGTCGATGAAG T7 terminator GCTAGTTATTGCTCAGCGG
pET15_8HMbpTEV_NESG MBPSeq Forward TCGTCAGACTGTCGATGAAG T7 terminator GCTAGTTATTGCTCAGCGG
pET15_NESG T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pET15-6HCBPT_TF T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pET15Avi6HT_NESG T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pET15b T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pET15-CBP6HT_TF T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pET15Nano6HT_NESG T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pET15TEV_NESG T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG

pET15Sumo_NESG

T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pET16b T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pET16-DEST T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pET21 NESG T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pET21_NESG T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pET23b T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pET28a T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pET28a-MISTIC p28mis forward CGAACCGCTGATCCAACTGG p28mis reverse GATATAGTTCCTCCTTTCAGC
pET28b(+) T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pET28b-C-His T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pET28-N-His-SUMO T7 TAATACGACTCACTATAG ISFI_newrev TTTGTTAGCAGCCGGATCTCAGTGG
pET28-N-His-thromb T7 TAATACGACTCACTATAG ISFI_newrev TTTGTTAGCAGCCGGATCTCAGTGG
pET28-N-His-thromb-C-strep T7 TAATACGACTCACTATAG ISFI_newrev TTTGTTAGCAGCCGGATCTCAGTGG
pET30a(+) T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pET32-DEST T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pET-32b-TEV TRXF GTTGAAAGAGTTCCTCGACG T7 terminator GCTAGTTATTGCTCAGCGG
pET46EK-LIC T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pET-DUETm pET Upstream ATGCGTCCGGCGTAGA T7 terminator TATGCTAGTTATTGCTCAG
pEU-E01 pEUfor GGTGACACTATAGAACTCA pEUrev GGCGCTAGCCGTAAATTCT
pEU-GST GST Forward CTTCGATAGGGTGTTTAACT pEU Reverse CCCGCTTCGCCGCCGCAGAAT
pEU-GST-FV GST Forward CTTCGATAGGGTGTTTAACT pEU Reverse CCCGCTTCGCCGCCGCAGAAT
pEU-His His2 Forward AGAAAGTTTATGAAGATCGATCTCAT pEU Reverse CCCGCTTCGCCGCCGCAGAAT
pEU-His-FV pEU319 Forward  GTCGTTAGAACGCGGCTAC pEU Reverse CCCGCTTCGCCGCCGCAGAAT
pEU-HSBC His2 Forward AGAAAGTTTATGAAGATCGATCTCAT T7 terminator TATGCTAGTTATTGCTCAG
pFAB007 pFAB007 GGACGCATCGTGGCCC
pFASTBAC1 pFB Forward TATTCCGGATTATTCATACC pFB Reverse ACAAATGTGGTATGGCTGATT
pFASTBAC1-C-His-TOPO pFB forward TATTCCGGATTATTCATACC      pFB reverse ACAAATGTGGTATGGCTGATT 
pGEc1-DEST pGEc1-DEST F AGAGCTGGTTTAGTGAACCGTC pGEn1-DEST R TGACAACGGGCCACAACTCCTC
pGEc2-DEST pGEc1-DEST F AGAGCTGGTTTAGTGAACCGTC pGEn1-DEST R TGACAACGGGCCACAACTCCTC
pGEn1-DEST pGEn3-DEST-5'F AGCATGCACCACCACCATCACC  pGEn1-DEST R TGACAACGGGCCACAACTCCTC
pGEn2-DEST pGEn2-DEST F GACAATCACTACCTGAGCACCA pGEn1-DEST R TGACAACGGGCCACAACTCCTC
pGEn3-DEST pGEn3-DEST-5'F AGCATGCACCACCACCATCACC  pGEn1-DEST R TGACAACGGGCCACAACTCCTC
pGEXTEV pGEX5  GGGCTGGCAAGCCACGTTTGGTG pGEX3  CCGGGAGCTGCATGTGTCAGAGG
pGH M13F GTAAAACGACGGCCAGT M13R CAGGAAACAGCTATGACC
pH3c-LIC T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pHIS8 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pHIS9 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pHM3C-LIC T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pJ2 M13F GTAAAACGACGGCCAGT M13R CAGGAAACAGCTATGACC
pJ4 M13F GTAAAACGACGGCCAGT M13R CAGGAAACAGCTATGACC
pJFT7_cHalo_DC NAP150 CCCATTGTATGGGATCTGATC cHaloseqR CAACATCGACGTAGTGCAT
pJFT7_cHalo_empty NAP150 CCCATTGTATGGGATCTGATC cHaloseqR CAACATCGACGTAGTGCAT
pJFT7_cHalo-3xFlag_DC NAP150 CCCATTGTATGGGATCTGATC cHaloseqR CAACATCGACGTAGTGCAT
pJFT7_cHalo-3xHA_DC NAP150 CCCATTGTATGGGATCTGATC cHaloseqR CAACATCGACGTAGTGCAT
pJFT7_n3xFlag-Halo_DC HaloseqF AAGCCTGCCTAACTGCAA NAP138R TGTTTCGCCATTTATCACCTT
pJFT7_n3xHA-Halo_DC HaloseqF AAGCCTGCCTAACTGCAA NAP138R TGTTTCGCCATTTATCACCTT
pJFT7_nFlag_cHalo_DC NAP150 CCCATTGTATGGGATCTGATC cHaloseqR CAACATCGACGTAGTGCAT
pJFT7_nGST_CD-r2 GSTseqF GCAAGTATATAGCATGGCCT pCPD6268_R       AGCCAACTCAGCTTCCTTT
pJFT7_nGST_DC GSTseqF GCAAGTATATAGCATGGCCT                                    nap1273r TAAACGTTCAATTGCTATTATCACG
pJFT7_nHA_cHalo_DC NAP150 CCCATTGTATGGGATCTGATC cHaloseqR CAACATCGACGTAGTGCAT
pJFT7_nHALO_DC HaloseqF AAGCCTGCCTAACTGCAA pANT1491R TTTTTGTTTAAACTACCACTTT
pJFT7_nHalo_DC(r3) HaloseqF AAGCCTGCCTAACTGCAA            pCPD6268_R       AGCCAACTCAGCTTCCTTT                                         
pJFT7_nHalo_DC(r4) HaloseqF AAGCCTGCCTAACTGCAA            pCPD6268_R       AGCCAACTCAGCTTCCTTT                                         
pJFT7_nHalo_empty NAP150 CCCATTGTATGGGATCTGATC T7 terminator TATGCTAGTTATTGCTCAG
pJFT7_nHIS_cHalo_DC NAP150 CCCATTGTATGGGATCTGATC cHaloseqR CAACATCGACGTAGTGCAT
pJFT7_nSNAP_DC snap_484F CTCGCCGTGAAAGAGTGG   NAP138R TGTTTCGCCATTTATCACCTT
pJP1520 JPO113 GCGGTTTTGGCAGTACATCAATGGGCG
pJP1563 JPO113 GCGGTTTTGGCAGTACATCAATGGGCG
pJSP6_cHalo_DC SP6 catacgatttaggtgacactatag cHaloSeqR CAACATCGACGTAGTGCAT
pJSP6_nGST_DC GSTseqF GCAAGTATATAGCATGGCCT                                    pF1KseqR CTTTCGGGCTTTGTTAGCAG
pJSP6_nHalo_DC HaloseqF AAGCCTGCCTAACTGCAA pF1KseqR CTTTCGGGCTTTGTTAGCAG
pJSP6_nHalo_empty HaloseqF AAGCCTGCCTAACTGCAA pF1KseqR CTTTCGGGCTTTGTTAGCAG
pJSP6_nSNAP_DC snap_484F CTCGCCGTGAAAGAGTGG   pF1KseqR CTTTCGGGCTTTGTTAGCAG
pLDNT7_nFLAG T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pLenti4/V5-DEST CMV forward CGCAAATGGGCGGTAGGCGTG V5 reverse ACCGAGGAGAGGGTTAGGGAT
pLenti6.2/V5-DEST CMV forward CGCAAATGGGCGGTAGGCGTG V5 reverse ACCGAGGAGAGGGTTAGGGAT
pLIC-CH T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pLIC-EGFP T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pLIFE-miRNA M13F GTAAAACGACGGCCAGT M13R CAGGAAACAGCTATGACC
pLP-DS3xFlag M13F GTAAAACGACGGCCAGT T7 terminator GCTAGTTATTGCTCAGCGG
pLP-DS3xMyc M13F GTAAAACGACGGCCAGT T7 terminator GCTAGTTATTGCTCAGCGG
pLP-EGFP-C1 EGFP-C CATGGTCCTGCTGGAGTTCGTG EGFP-N CGTCGCCGTCCAGCTCGACCAG
pLPS-3'EGFP EGFP-C CATGGTCCTGCTGGAGTTCGTG EGFP-N CGTCGCCGTCCAGCTCGACCAG
pMA507 T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pMA510 T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pMAL-c5e_MHAT malE GGTCGTCAGACTGTCGATGAAGCC pMal TGTCCTACTCAGGAGAGCGTTCAC
pMAPLe3 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
MBP-MPR-TM MBP Seq Forward  TCGTCAGACTGTCGATGAAG PQEREV GTTCTGAGGTCATTACTGG
pMCentr1 M13F GTAAAACGACGGCCAGT M13R CAGGAAACAGCTATGACC
pMCentr2 M13F GTAAAACGACGGCCAGT M13R CAGGAAACAGCTATGACC
pMCentr3 M13F GTAAAACGACGGCCAGT M13R CAGGAAACAGCTATGACC
pMCSG10 T7short TAATACGACTCACTATAGGG T7 terminator GCTAGTTATTGCTCAGCGG
pMCSG11 DuetUp1 GGATCTCGACGCTCTCCCT T7 terminator GCTAGTTATTGCTCAGCGG
pMCSG12 T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pMCSG13 T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pMCSG14 T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pMCSG17 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pMCSG18 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pMCSG19 ANForward CGTTTCCAGTCTCACCACC T7 terminator GCTAGTTATTGCTCAGCGG
pMCSG19B ANForward CGTTTCCAGTCTCACCACC T7 terminator GCTAGTTATTGCTCAGCGG
pMCSG19C T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pMCSG20 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pMCSG21 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pMCSG22 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pMCSG23 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pMCSG24 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pMCSG26 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pMCSG28 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pMCSG29 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pMCSG32 T7short TAATACGACTCACTATAGGG T7 terminator GCTAGTTATTGCTCAGCGG
pMCSG48 pMCSG48F GAAGGGTTGACCGACGAAAAAGC T7 terminator GCTAGTTATTGCTCAGCGG
pMCSG49 T7 short TAATACGACTCACTATAGGG T7 terminator GCTAGTTATTGCTCAGCGG
pMCSG51 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pMCSG53 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pMCSG54 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pMCSG55 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pMCSG56 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pMCSG57 T7short TAATACGACTCACTATAGGG T7 terminator GCTAGTTATTGCTCAGCGG
pMCSG58 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pMCSG59 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pMCSG60 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pMCSG62 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pMCSG63 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pMCSG68 T7short TAATACGACTCACTATAGGG T7 terminator GCTAGTTATTGCTCAGCGG
pMCSG69 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pMCSG7 T7short TAATACGACTCACTATAGGG T7 terminator GCTAGTTATTGCTCAGCGG
pMCSG70 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pMCSG71 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pMCSG73 MCSG73F TATGGCTGCCCGTAATAACAACAAC T7 terminator TATGCTAGTTATTGCTCAG
pMCSG75 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pMCSG76 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pMCSG77 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pMCSG8 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pMCSG9 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pMH1 pBAD forward ATGCCATAGCATTTTTATCC alt_bad_rev GATTTAATCTGTATCAGG
pMH1TEV pBAD forward ATGCCATAGCATTTTTATCC alt_bad_rev GGGTCAGGTGGGACCAC
pMH2T7 pBAD forward ATGCCATAGCATTTTTATCC alt_bad_rev GGGTCAGGTGGGACCAC
pMH2T7TEV pBAD forward ATGCCATAGCATTTTTATCC alt_bad_rev GGGTCAGGTGGGACCAC
pMH4 pBAD forward ATGCCATAGCATTTTTATCC alt_bad_rev GGGTCAGGTGGGACCAC
pMH4TEV pBAD forward ATGCCATAGCATTTTTATCC alt_bad_rev GGGTCAGGTGGGACCAC
pMHTDelta238 pMHTDelta238-F ACGCCCAGAAAGGTGAAATCATGC pMHTDelta238-R TGAGTCGCTTCCTTAACTGGCTGA
pMIS2.1mv T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pMKQ pBAD forward ATGCCATAGCATTTTTATCC alt_bad_rev GGGTCAGGTGGGACCAC
pMYC4-H Phsp AGGTGACCACAACGACGC
pMYC4-Hp Phsp AGGTGACCACAACGACGC
pMYC4-I Ps-Pimyc CTGTTTAAACGGATCGTCG
pMYC4-S Ps-Pimyc CTGTTTAAACGGATCGTCG
pMYC5-H Phsp AGGTGACCACAACGACGC
pNIC28-Bsa4 pLICf TGTGAGCGGATAACAATTCC pLIC rev AGCAGCCAACTCAGCTTCC
pNYCOMPS1 T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pNYCOMPS-LIC-FH10T+ (N term) T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pNYCOMPS-TH-ccdB (C-term.) T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pNYSGXRC T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pPic3.5K pPIC3-5F GACTGGTTCCAATTGACAAGC pPIC3-5R  GCAAATGGCATTCTGACATCC
pPic3.5K  pPIC3-5F GACTGGTTCCAATTGACAAGC pPIC3-5R  GCAAATGGCATTCTGACATCC
pPICZa AOX1 GACTGGTTCCAATTGACAAGC pAOX1 Reverse GCAAATGGCATTCTGACATCC
pRETRO-SUPER pSUPER-for GGAAGCCTTGGCTTTTG
pRSET-C6xHis T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pRSET-C8xHis T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG

pRSET-natGFP

T7 TAATACGACTCACTATAG GFPR TCTCCACTGACAGAAAATTTGTGC
pRSET-natGFPHis T7 TAATACGACTCACTATAG GFPR TCTCCACTGACAGAAAATTTGTGC
pRSET-natTEVGFPHis T7 TAATACGACTCACTATAG GFPR TCTCCACTGACAGAAAATTTGTGC
pRSET-YtfM-8xHis-N-term T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pRSET-YtfM-AN T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pRSF/TEV/LIC T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pSB2 T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pSB3 T7 TAATACGACTCACTATAG T7 terminator GCTAGTTATTGCTCAGCGG
pSFV3 pFAB007 GGACGCATCGTGGCCC
pSFV4 pFAB007 GGACGCATCGTGGCCC
pSGP17 pSGP-Forward CAACATTTTCAGTTTGTATTACTTC pSGP-Reverse CAATCAACTATCAACTATTAACTA
pSGP18 pSGP18for CACCTGTGCCGAAACGCAAATG
pSGP36 pSGP36 forward CAACATTTTCAGTTTGTATTACTTC pSGP36 reverse CAAGGCGATTAAGTTGGGTAACGC
pSGP40 pSGP-Forward CAACATTTTCAGTTTGTATTACTTC pSGP-Reverse CAATCAACTATCAACTATTAACTA
pSGP46 pSGP-Forward CAACATTTTCAGTTTGTATTACTTC pSGP-Reverse CAATCAACTATCAACTATTAACTA
pSGP47 pSGP-Forward CAACATTTTCAGTTTGTATTACTTC pSGP-Reverse CAATCAACTATCAACTATTAACTA
pSGX2 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pSGX3 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pSGX4 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pSGX4 BS T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pSGX5 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pSGX6 T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pSGX6 SP T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pSGX-TOPO pFB forward TATTCCGGATTATTCATACC      pFB reverse ACAAATGTGGTATGGCTGATT 
pSpeedE pBAD forward ATGCCATAGCATTTTTATCC alt_bad_rev GGGTCAGGTGGGACCAC
pSpeedE5T pBAD forward ATGCCATAGCATTTTTATCC alt_bad_rev GGGTCAGGTGGGACCAC
pSpeedEDT pBAD forward ATGCCATAGCATTTTTATCC alt_bad_rev GGGTCAGGTGGGACCAC
pSpeedEGST GST Forward CTTCGATAGGGTGTTTAACT alt_bad_rev GGGTCAGGTGGGACCAC
pSpeedENATS pBAD forward ATGCCATAGCATTTTTATCC alt_bad_rev GGGTCAGGTGGGACCAC
pSpeedET pBAD forward ATGCCATAGCATTTTTATCC alt_bad_rev GGGTCAGGTGGGACCAC
pSpeedETS pBAD forward ATGCCATAGCATTTTTATCC alt_bad_rev GGGTCAGGTGGGACCAC
pTYB12-Intein T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
pVP13 MBP Forward CTACAGGCGAAAGACCATACG pQE Reverse CAAGACTCCAGTAATGACC
pVP16 MBP Forward CTACAGGCGAAAGACCATACG pQE Reverse CAAGACTCCAGTAATGACC
pVP33A MBP Forward CTACAGGCGAAAGACCATACG T7 Terminator TATGCTAGTTATTGCTCAG
pVP33K MBP Forward CTACAGGCGAAAGACCATACG T7 Terminator TATGCTAGTTATTGCTCAG
pVP56A MBP Forward CTACAGGCGAAAGACCATACG T7 Terminator TATGCTAGTTATTGCTCAG
pVP56K MBP Forward CTACAGGCGAAAGACCATACG T7 Terminator TATGCTAGTTATTGCTCAG
pVP65K MBP Forward CTACAGGCGAAAGACCATACG T7 Terminator TATGCTAGTTATTGCTCAG
pVP68K MBP Forward CTACAGGCGAAAGACCATACG T7 Terminator TATGCTAGTTATTGCTCAG
pVP80K MBP Forward CTACAGGCGAAAGACCATACG T7 Terminator TATGCTAGTTATTGCTCAG
pVP81K MBP Forward CTACAGGCGAAAGACCATACG T7 Terminator TATGCTAGTTATTGCTCAG
RH2.2 pFAB007 GGACGCATCGTGGCCC
Topo Wild T7 TAATACGACTCACTATAG T7 terminator TATGCTAGTTATTGCTCAG
ZM552 M13F GTAAAACGACGGCCAGT M13R CAGGAAACAGCTATGACC