DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : POU5F1 (OCT4), SOX2, NANOG repress genes related to differentiation, 43 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00041171 Plasmid Details cDNA DKK1 dickkopf homolog 1 (Xenopus laevis) NA BC001539 No/No FUSION pDONR221 bacterial:kanamycin
2 HsCD00044285 Plasmid Details cDNA DKK1 dickkopf homolog 1 (Xenopus laevis) NA BC001539 No/No CLOSED pDONR221 bacterial:kanamycin
3 HsCD00045643 Plasmid Details cDNA CDX2 caudal type homeobox transcription factor 2 NA BC014461 No/No CLOSED pDONR221 bacterial:kanamycin
4 HsCD00076146 Plasmid Details cDNA CDX2 caudal type homeo box transcription factor 2 NA BC014461 No/No FUSION pDONR221 bacterial:kanamycin
5 HsCD00079547 Plasmid Details cDNA HHEX hematopoietically expressed homeobox NA BC050638 No/No FUSION pDONR221 bacterial:kanamycin
6 HsCD00079634 Plasmid Details cDNA NANOG Nanog homeobox NA BC098275 No/No FUSION pDONR221 bacterial:kanamycin
7 HsCD00079917 Plasmid Details cDNA SOX2 SRY (sex determining region Y)-box 2 NA BC013923 No/No FUSION pDONR221 bacterial:kanamycin
8 HsCD00295548 Plasmid Details cDNA NANOG Nanog homeobox NA NM_024865.2 No/No CLOSED pENTR223.1 bacterial:spectinomycin
9 HsCD00313690 Plasmid Details cDNA NANOG Nanog homeobox full-length cds BC099704 No/No CLOSED pDONR221 bacterial:kanamycin
10 HsCD00329522 Plasmid Details cDNA SOX2 SRY (sex determining region Y)-box 2 NA BC013923 No/No FUSION pLenti6.2/V5-DEST mammalian:blasticidin
11 HsCD00329621 Plasmid Details cDNA HHEX hematopoietically expressed homeobox NA BC050638 No/No FUSION pLenti6.2/V5-DEST mammalian:blasticidin
12 HsCD00329699 Plasmid Details cDNA NANOG Nanog homeobox NA BC098275 No/No FUSION pLenti6.2/V5-DEST mammalian:blasticidin
13 HsCD00330239 Plasmid Details cDNA CDX2 caudal type homeo box transcription factor 2 NA BC014461 No/No FUSION pLenti6.2/V5-DEST mammalian:blasticidin
14 HsCD00353574 Plasmid Details cDNA POU5F1 POU class 5 homeobox 1 NA HQ258221 No/No FUSION pDONR223 bacterial:spectinomycin
15 HsCD00403351 Plasmid Details cDNA POU5F1 POU class 5 homeobox 1 NA HQ258221 No/No FUSION pANT7_cGST bacterial:ampicillin
16 HsCD00436328 Plasmid Details cDNA SOX2 SRY (sex determining region Y)-box 2 NA EU446654 No/No FUSION pLX304 mammalian:blasticidin
17 HsCD00436800 Plasmid Details cDNA NANOG Nanog homeobox NA EU446847 No/No FUSION pLX304 mammalian:blasticidin
18 HsCD00437775 Plasmid Details cDNA TSC22D1 TSC22 domain family, member 1 NA No/No FUSION pLX304 mammalian:blasticidin
19 HsCD00440071 Plasmid Details cDNA CDX2 caudal type homeobox 2 NA EU176674 No/No FUSION pLX304 mammalian:blasticidin
20 HsCD00441053 Plasmid Details cDNA DKK1 dickkopf 1 homolog (Xenopus laevis) NA DQ895421 No/No FUSION pLX304 mammalian:blasticidin
21 HsCD00446942 Plasmid Details cDNA POU5F1 POU class 5 homeobox 1 NA HQ258573 No/No FUSION pLX304 mammalian:blasticidin
22 HsCD00505132 Plasmid Details cDNA TSC22D1 TSC22 domain family, member 1 NA No/No FUSION pENTR223 bacterial:spectinomycin
23 HsCD00508539 Plasmid Details cDNA DKK1 dickkopf 1 homolog (Xenopus laevis) NA DQ895421 No/No FUSION pENTR223 bacterial:spectinomycin
24 HsCD00509775 Plasmid Details cDNA SOX2 SRY (sex determining region Y)-box 2 NA EU446654 No/No FUSION pENTR223 bacterial:spectinomycin
25 HsCD00509790 Plasmid Details cDNA NANOG Nanog homeobox NA EU446847 No/No FUSION pENTR223 bacterial:spectinomycin
26 HsCD00510758 Plasmid Details cDNA POU5F1 POU class 5 homeobox 1 NA HQ258573 No/No FUSION pENTR223 bacterial:spectinomycin
27 HsCD00511660 Plasmid Details cDNA CDX2 caudal type homeobox 2 NA EU176674 No/No FUSION pENTR223 bacterial:spectinomycin
28 HsCD00515086 Plasmid Details cDNA GSC goosecoid homeobox NA No/No FUSION pENTR223 bacterial:spectinomycin
29 HsCD00546294 Plasmid Details cDNA SOX2 SRY (sex determining region Y)-box 2 NA No/No CLOSED pSpeedET bacterial:kanamycin
30 HsCD00547784 Plasmid Details cDNA NANOG Nanog homeobox NA NM_024865 No/No CLOSED pSpeedET bacterial:kanamycin
31 HsCD00626632 Plasmid Details cDNA SOX2 SRY (sex determining region Y)-box 2 partial cds BC013923 No/No FUSION pSpeedET bacterial:kanamycin
32 HsCD00640531 Plasmid Details cDNA HHEX hematopoietically expressed homeobox NA BC050638 No/No FUSION pANT7_cGST bacterial:ampicillin
33 HsCD00640584 Plasmid Details cDNA HHEX hematopoietically expressed homeobox NA NM_002729 No/No FUSION pANT7_cGST bacterial:ampicillin
34 HsCD00651327 Plasmid Details cDNA NANOG Nanog homeobox targeted domain No/Yes CLOSED pET15Nano6HT_NESG bacterial:ampicillin
35 HsCD00651403 Plasmid Details cDNA SOX2 SRY (sex determining region Y)-box 2 targeted domain No/No CLOSED pET15Nano6HT_NESG bacterial:ampicillin
36 HsCD00663854 Plasmid Details cDNA HHEX hematopoietically expressed homeobox targeted domain No/No CLOSED pET15Nano6HT_NESG bacterial:ampicillin
37 HsUT00698812 Plasmid Details 3'UTR QSCN6 quiescin Q6 sulfhydryl oxidase 1 Sequence Verified: Yes; 3'UTR length: 1177; Forward Primer: TGGCCACCCTGCAGCCTG; Reverse Primer: CAGACAGTTCTATGGGCAGTCTGT NM_002826 No/No NA P2RP3 bacterial:kanamycin
38 HsUT00699131 Plasmid Details 3'UTR HAND2 heart and neural crest derivatives expressed 2 Sequence Verified: Yes; 3'UTR length: 956; Forward Primer: CTGGAGCTCAAGCAGTGA; Reverse Primer: GGAAGGAGACACCACACCGA NM_021973 No/No NA P2RP3 bacterial:kanamycin
39 HsCD00730005 Plasmid Details cDNA CDX2 caudal type homeobox 2 NA BC014461 No/No FUSION pANT7_cGST bacterial:ampicillin
40 HsCD00731534 Plasmid Details cDNA NANOG Nanog homeobox NA BC098275 No/No FUSION pANT7_cGST bacterial:ampicillin
41 HsCD00731549 Plasmid Details cDNA SOX2 SRY (sex determining region Y)-box 2 NA BC013923 No/No FUSION pANT7_cGST bacterial:ampicillin
42 HsCD00732385 Plasmid Details cDNA DKK1 dickkopf WNT signaling pathway inhibitor 1 NA BC001539 No/No FUSION pANT7_cGST bacterial:ampicillin
43 HsCD00817669 Plasmid Details cDNA NANOG Nanog homeobox "insert_ID 54506,DNASU_Clone_ID HsCD00079634" BC098275 No/No FUSION pJFT7_nHalo_DC(r4) bacterial:ampicillin
No of Result Per Page : Page: