DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Platelet calcium homeostasis, 38 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00041259 Plasmid Details cDNA STIM1 stromal interaction molecule 1 NA BC021300 No/No FUSION pDONR221 bacterial:kanamycin
2 HsCD00045334 Plasmid Details cDNA ATP2A3 ATPase, Ca++ transporting, ubiquitous NA BC035729 No/No CLOSED pDONR221 bacterial:kanamycin
3 HsCD00076162 Plasmid Details cDNA STIM1 stromal interaction molecule 1 NA BC021300 No/No CLOSED pDONR221 bacterial:kanamycin
4 HsCD00076313 Plasmid Details cDNA ATP2A3 ATPase, Ca++ transporting, ubiquitous NA BC035729 No/No FUSION pDONR221 bacterial:kanamycin
5 HsCD00078099 Plasmid Details cDNA STIM1 stromal interaction molecule 1 NA BC021300 No/No FUSION pANT7_cGST bacterial:ampicillin
6 HsCD00082487 Plasmid Details cDNA ATP2B4 ATPase, Ca++ transporting, plasma membrane 4 NA BX537444 No/Yes FUSION pDONR201 bacterial:kanamycin
7 HsCD00082492 Plasmid Details cDNA ATP2B4 ATPase, Ca++ transporting, plasma membrane 4 NA BX537444 No/Yes FUSION pDONR201 bacterial:kanamycin
8 HsCD00083023 Plasmid Details cDNA ATP2A1 ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 NA NM_173201 No/No FUSION pENTR223.1 bacterial:spectinomycin
9 HsCD00289110 Plasmid Details cDNA P2RX1 purinergic receptor P2X, ligand-gated ion channel, 1 NA BC044657.1 No/No FUSION pENTR223 bacterial:spectinomycin
10 HsCD00295135 Plasmid Details cDNA SLC8A2 solute carrier family 8 (sodium/calcium exchanger), member 2 NA NM_015063.1 No/No CLOSED pENTR223.1 bacterial:spectinomycin
11 HsCD00295177 Plasmid Details cDNA SLC8A3 solute carrier family 8 (sodium/calcium exchanger), member 3 NA NM_183002.1 No/No CLOSED pENTR223.1 bacterial:spectinomycin
12 HsCD00351293 Plasmid Details cDNA SLC8A3 solute carrier family 8 (sodium/calcium exchanger), member 3 NA BC160014 No/No CLOSED pENTR223.1 bacterial:spectinomycin
13 HsCD00351391 Plasmid Details cDNA ATP2A1 ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 NA BC148653 No/No FUSION pENTR223.1 bacterial:spectinomycin
14 HsCD00352937 Plasmid Details cDNA P2RX1 purinergic receptor P2X, ligand-gated ion channel, 1 NA HQ448505 No/No FUSION pDONR223 bacterial:spectinomycin
15 HsCD00356549 Plasmid Details cDNA ATP2A1 ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 NA BC148653 No/No FUSION pANT7_cGST bacterial:ampicillin
16 HsCD00358096 Plasmid Details cDNA P2RX1 purinergic receptor P2X, ligand-gated ion channel, 1 NA HQ448505 No/No FUSION pANT7_cGST bacterial:ampicillin
17 HsCD00437019 Plasmid Details cDNA ATP2B3 ATPase, Ca++ transporting, plasma membrane 3 NA No/Yes FUSION pLX304 mammalian:blasticidin
18 HsCD00437023 Plasmid Details cDNA TRPC7 transient receptor potential cation channel, subfamily C, member 7 NA No/No FUSION pLX304 mammalian:blasticidin
19 HsCD00437056 Plasmid Details cDNA ATP2B2 ATPase, Ca++ transporting, plasma membrane 2 NA No/No FUSION pLX304 mammalian:blasticidin
20 HsCD00437344 Plasmid Details cDNA ORAI1 ORAI calcium release-activated calcium modulator 1 NA No/No FUSION pLX304 mammalian:blasticidin
21 HsCD00439538 Plasmid Details cDNA P2RX1 purinergic receptor P2X, ligand-gated ion channel, 1 NA HQ448505 No/No FUSION pLX304 mammalian:blasticidin
22 HsCD00440352 Plasmid Details cDNA SLC8A3 solute carrier family 8 (sodium/calcium exchanger), member 3 NA BC160014 No/Yes FUSION pLX304 mammalian:blasticidin
23 HsCD00442547 Plasmid Details cDNA P2RX1 purinergic receptor P2X, ligand-gated ion channel, 1 NA HQ448505 No/No FUSION pLX304 mammalian:blasticidin
24 HsCD00505411 Plasmid Details cDNA ATP2B2 ATPase, Ca++ transporting, plasma membrane 2 NA No/No FUSION pENTR223 bacterial:spectinomycin
25 HsCD00505807 Plasmid Details cDNA TRPC7 transient receptor potential cation channel, subfamily C, member 7 NA No/No FUSION pENTR223 bacterial:spectinomycin
26 HsCD00508839 Plasmid Details cDNA SLC8A3 solute carrier family 8 (sodium/calcium exchanger), member 3 NA BC160014 No/Yes FUSION pENTR223 bacterial:spectinomycin
27 HsCD00510510 Plasmid Details cDNA P2RX1 purinergic receptor P2X, ligand-gated ion channel, 1 NA HQ448505 No/No FUSION pENTR223 bacterial:spectinomycin
28 HsCD00512801 Plasmid Details cDNA P2RX1 purinergic receptor P2X, ligand-gated ion channel, 1 NA HQ448505 No/No FUSION pENTR223 bacterial:spectinomycin
29 HsCD00516335 Plasmid Details cDNA TRPC3 transient receptor potential cation channel, subfamily C, member 3 NA No/No FUSION pENTR223 bacterial:spectinomycin
30 HsCD00622598 Plasmid Details cDNA ORAI1 ORAI calcium release-activated calcium modulator 1 PERFECT_MATCH BC015369.1 No/No FUSION pENTR223 bacterial:spectinomycin
31 HsCD00631244 Plasmid Details cDNA SLC8A3 solute carrier family 8 (sodium/calcium exchanger), member 3 NA No/No FUSION pANT7_cGST bacterial:ampicillin
32 HsCD00641521 Plasmid Details cDNA TRPC7 transient receptor potential cation channel, subfamily C, member 7 NA NM_020389 No/No FUSION pANT7_cGST bacterial:ampicillin
33 HsCD00641964 Plasmid Details cDNA TRPC3 transient receptor potential cation channel, subfamily C, member 3 NA NM_001130698 No/No FUSION pANT7_cGST bacterial:ampicillin
34 HsUT00698086 Plasmid Details 3'UTR SATB1 SATB homeobox 1 Sequence Verified: Yes; 3'UTR length: 1709; Forward Primer: ACAGACATTAATACTGATTTGAAAGACTGA; Reverse Primer: TGAAAAAAAAAAGCTAAGGGGTTTTTATAC NM_001131010 No/No NA P2RP3 bacterial:kanamycin
35 HsCD00719228 Plasmid Details cDNA ORAI1 ORAI calcium release-activated calcium modulator 1 NA BC075831 No/No FUSION pDONR221 bacterial:kanamycin
36 HsCD00731696 Plasmid Details cDNA ATP2A1 ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 NA NM_173201 No/No FUSION pANT7_cGST bacterial:ampicillin
37 HsCD00732212 Plasmid Details cDNA P2RX1 purinergic receptor P2X, ligand gated ion channel, 1 NA BC044657 No/No FUSION pANT7_cGST bacterial:ampicillin
38 HsCD00732464 Plasmid Details cDNA ATP2A1 ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 NA BC035729 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: