DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results

TOP

Pathway : Lysine catabolism, 40 clones found

No of Result Per Page : Page: Explanation of Terms
  DNASU
Plasmid ID
Clone
Type
Gene
Symbol
Gene
Name
Keywords Reference
Sequence
Mutation/
Discrepancy
Insert
Format
Vector Selection
Markers
 
1 HsCD00002806 Plasmid Details cDNA ALDH7A1 aldehyde dehydrogenase 7 family, member A1 NA BC002515 No/No FUSION pDNR-Dual bacterial:ampicillin
2 HsCD00002837 Plasmid Details cDNA GCDH glutaryl-Coenzyme A dehydrogenase NA BC002579 No/No FUSION pDNR-Dual bacterial:ampicillin
3 HsCD00002838 Plasmid Details cDNA GCDH glutaryl-Coenzyme A dehydrogenase NA BC002579 No/No FUSION pDNR-Dual bacterial:ampicillin
4 HsCD00002839 Plasmid Details cDNA GCDH glutaryl-Coenzyme A dehydrogenase NA BC002579 No/No CLOSED pDNR-Dual bacterial:ampicillin
5 HsCD00002840 Plasmid Details cDNA GCDH glutaryl-Coenzyme A dehydrogenase NA BC002579 No/No CLOSED pDNR-Dual bacterial:ampicillin
6 HsCD00043953 Plasmid Details cDNA OGDH oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) NA BC004964 No/No CLOSED pDONR221 bacterial:kanamycin
7 HsCD00076085 Plasmid Details cDNA OGDH oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) NA BC004964 No/No FUSION pDONR221 bacterial:kanamycin
8 HsCD00288118 Plasmid Details cDNA DLD dihydrolipoamide dehydrogenase NA BC018696.2 No/No FUSION pENTR223 bacterial:spectinomycin
9 HsCD00288436 Plasmid Details cDNA AADAT aminoadipate aminotransferase NA BC031068.1 No/No FUSION pENTR223 bacterial:spectinomycin
10 HsCD00288830 Plasmid Details cDNA DLST dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) NA BC000302.2 No/No FUSION pENTR223 bacterial:spectinomycin
11 HsCD00295837 Plasmid Details cDNA ALDH7A1 aldehyde dehydrogenase 7 family, member A1 NA BC002515.2 No/No CLOSED pDONR221 bacterial:kanamycin
12 HsCD00296093 Plasmid Details cDNA ALDH7A1 aldehyde dehydrogenase 7 family, member A1 NA BC002515.2 No/No FUSION pDONR221 bacterial:kanamycin
13 HsCD00303682 Plasmid Details cDNA DLD dihydrolipoamide dehydrogenase NA BC018696.2 No/No FUSION pANT7_cGST bacterial:ampicillin
14 HsCD00352225 Plasmid Details cDNA DLST dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) NA HQ448281 No/No FUSION pDONR223 bacterial:spectinomycin
15 HsCD00352564 Plasmid Details cDNA DLD dihydrolipoamide dehydrogenase NA HQ447584 No/No FUSION pDONR223 bacterial:spectinomycin
16 HsCD00352608 Plasmid Details cDNA AADAT aminoadipate aminotransferase NA HQ447955 No/No FUSION pDONR223 bacterial:spectinomycin
17 HsCD00356423 Plasmid Details cDNA DLD dihydrolipoamide dehydrogenase NA HQ447584 No/No FUSION pANT7_cGST bacterial:ampicillin
18 HsCD00357512 Plasmid Details cDNA DLST dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) NA HQ448281 No/No FUSION pANT7_cGST bacterial:ampicillin
19 HsCD00398969 Plasmid Details cDNA SLC25A21 solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21 NA HQ258164 No/No FUSION pDONR223 bacterial:spectinomycin
20 HsCD00403216 Plasmid Details cDNA AADAT aminoadipate aminotransferase NA HQ447955 No/No FUSION pANT7_cGST bacterial:ampicillin
21 HsCD00404120 Plasmid Details cDNA SLC25A21 solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21 NA HQ258164 No/No FUSION pANT7_cGST bacterial:ampicillin
22 HsCD00434106 Plasmid Details cDNA GCDH glutaryl-CoA dehydrogenase NA No/No FUSION pLX304 mammalian:blasticidin
23 HsCD00434126 Plasmid Details cDNA DLST dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) NA HQ448281 No/No FUSION pLX304 mammalian:blasticidin
24 HsCD00438216 Plasmid Details cDNA AADAT aminoadipate aminotransferase NA No/Yes FUSION pLX304 mammalian:blasticidin
25 HsCD00439750 Plasmid Details cDNA DLD dihydrolipoamide dehydrogenase NA HQ447584 No/No FUSION pLX304 mammalian:blasticidin
26 HsCD00440450 Plasmid Details cDNA SLC25A21 solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21 NA HQ258164 No/No FUSION pLX304 mammalian:blasticidin
27 HsCD00508988 Plasmid Details cDNA SLC25A21 solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21 NA HQ258164 No/No FUSION pENTR223 bacterial:spectinomycin
28 HsCD00510433 Plasmid Details cDNA DLD dihydrolipoamide dehydrogenase NA HQ447584 No/No FUSION pENTR223 bacterial:spectinomycin
29 HsCD00511890 Plasmid Details cDNA GCDH glutaryl-CoA dehydrogenase NA No/No FUSION pENTR223 bacterial:spectinomycin
30 HsCD00512078 Plasmid Details cDNA DLST dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) NA HQ448281 No/No FUSION pENTR223 bacterial:spectinomycin
31 HsCD00589575 Plasmid Details cDNA SLC25A21 solute carrier family 25 (mitochondrial oxoadipate carrier), member 21 full length protein truncation No/No CLOSED pET15_NESG bacterial:ampicillin
32 HsCD00589576 Plasmid Details cDNA SLC25A21 solute carrier family 25 (mitochondrial oxoadipate carrier), member 21 full length protein truncation No/No CLOSED pET15_NESG bacterial:ampicillin
33 HsCD00617842 Plasmid Details cDNA GCDH glutaryl-CoA dehydrogenase NA BC002579 No/No CLOSED pLDNT7_nFLAG bacterial:chloramphenicol
34 HsCD00631112 Plasmid Details cDNA GCDH glutaryl-CoA dehydrogenase NA No/No FUSION pANT7_cGST bacterial:ampicillin
35 HsCD00640665 Plasmid Details cDNA ALDH7A1 aldehyde dehydrogenase 7 family, member A1 NA NM_001182 No/No FUSION pANT7_cGST bacterial:ampicillin
36 HsCD00641066 Plasmid Details cDNA ALDH7A1 aldehyde dehydrogenase 7 family, member A1 NA BC002515 No/No FUSION pANT7_cGST bacterial:ampicillin
37 HsUT00698639 Plasmid Details 3'UTR PABPC4 poly(A) binding protein, cytoplasmic 4 (inducible form) Sequence Verified: Yes; 3'UTR length: 1065; Forward Primer: GTTGCTGCTGCTACCTCTTAG; Reverse Primer: GGATCATATTTAACAGTTCTGTGTATCTTG NM_003819 No/No NA P2RP3 bacterial:kanamycin
38 HsCD00732107 Plasmid Details cDNA AADAT aminoadipate aminotransferase NA BC031068 No/No FUSION pANT7_cGST bacterial:ampicillin
39 HsCD00732158 Plasmid Details cDNA DLST dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) NA BC000302 No/No FUSION pANT7_cGST bacterial:ampicillin
40 HsCD00732326 Plasmid Details cDNA OGDH oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) NA BC004964 No/No FUSION pANT7_cGST bacterial:ampicillin
No of Result Per Page : Page: