DNASU Plasmid Repository • 480.965.5697 | Email

Pathways Results


Pathway : Recycling of eIF2:GDP, 47 clones found

No of Result Per Page : Page: Explanation of Terms
Plasmid ID
Keywords Reference
Vector Selection
1 HsCD00001845 Plasmid Details cDNA EIF2S2 eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa NA BC000461 No/No CLOSED pDNR-Dual bacterial:ampicillin
2 HsCD00001846 Plasmid Details cDNA EIF2S2 eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa NA BC000461 No/No CLOSED pDNR-Dual bacterial:ampicillin
3 HsCD00001847 Plasmid Details cDNA EIF2S2 eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa NA BC000461 No/No CLOSED pDNR-Dual bacterial:ampicillin
4 HsCD00002811 Plasmid Details cDNA EIF2S1 eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa NA BC002513 No/No FUSION pDNR-Dual bacterial:ampicillin
5 HsCD00002812 Plasmid Details cDNA EIF2S1 eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa NA BC002513 No/No FUSION pDNR-Dual bacterial:ampicillin
6 HsCD00039870 Plasmid Details cDNA EIF2S2 eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa NA BC000934 No/No FUSION pDONR221 bacterial:kanamycin
7 HsCD00040230 Plasmid Details cDNA EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa NA BC000494 No/No FUSION pDONR221 bacterial:kanamycin
8 HsCD00040356 Plasmid Details cDNA EIF2B5 eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa NA BC013590 No/No FUSION pDONR221 bacterial:kanamycin
9 HsCD00040751 Plasmid Details cDNA EIF2S3 eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa NA BC019906 No/No FUSION pDONR221 bacterial:kanamycin
10 HsCD00041097 Plasmid Details cDNA EIF2S1 eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa NA BC002513 No/No FUSION pDONR221 bacterial:kanamycin
11 HsCD00042474 Plasmid Details cDNA EIF2A eukaryotic translation initiation factor 2A, 65kDa NA BC011885 No/No FUSION pDONR221 bacterial:kanamycin
12 HsCD00043022 Plasmid Details cDNA EIF2S2 eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa NA BC000934 No/No CLOSED pDONR221 bacterial:kanamycin
13 HsCD00043381 Plasmid Details cDNA EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa NA BC000494 No/Yes CLOSED pDONR221 bacterial:kanamycin
14 HsCD00043500 Plasmid Details cDNA EIF2B5 eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa NA BC013590 No/No CLOSED pDONR221 bacterial:kanamycin
15 HsCD00043877 Plasmid Details cDNA EIF2S3 eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa NA BC019906 No/No CLOSED pDONR221 bacterial:kanamycin
16 HsCD00044214 Plasmid Details cDNA EIF2S1 eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa NA BC002513 No/No CLOSED pDONR221 bacterial:kanamycin
17 HsCD00077115 Plasmid Details cDNA EIF2S1 eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa NA BC002513 No/No FUSION pANT7_cGST bacterial:ampicillin
18 HsCD00082287 Plasmid Details cDNA EIF2B3 eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa NA AL834288 No/No FUSION pDONR201 bacterial:kanamycin
19 HsCD00082288 Plasmid Details cDNA EIF2B3 eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa NA AL834288 No/No FUSION pDONR201 bacterial:kanamycin
20 HsCD00084125 Plasmid Details cDNA EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa NA BC003165 No/No CLOSED pVP16 bacterial:ampicillin
21 HsCD00300133 Plasmid Details cDNA EIF2B5 eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa NA BC013590 No/No FUSION pANT7_cGST bacterial:ampicillin
22 HsCD00312730 Plasmid Details cDNA EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa full-length cds BC000494 No/No CLOSED pDONR221 bacterial:kanamycin
23 HsCD00433988 Plasmid Details cDNA EIF2S2 eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa NA DQ894184 No/No FUSION pLX304 mammalian:blasticidin
24 HsCD00434186 Plasmid Details cDNA EIF2S3 eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa NA No/Yes FUSION pLX304 mammalian:blasticidin
25 HsCD00434720 Plasmid Details cDNA EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa NA DQ894544 No/No FUSION pLX304 mammalian:blasticidin
26 HsCD00438061 Plasmid Details cDNA EIF2B4 eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa NA No/No FUSION pLX304 mammalian:blasticidin
27 HsCD00441439 Plasmid Details cDNA EIF2S2 eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa NA DQ894184 No/No FUSION pLX304 mammalian:blasticidin
28 HsCD00444915 Plasmid Details cDNA EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa NA DQ894544 No/No FUSION pLX304 mammalian:blasticidin
29 HsCD00446722 Plasmid Details cDNA EIF2B1 eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa NA No/No FUSION pLX304 mammalian:blasticidin
30 HsCD00510013 Plasmid Details cDNA EIF2S2 eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa NA DQ894184 No/No FUSION pENTR223 bacterial:spectinomycin
31 HsCD00510089 Plasmid Details cDNA EIF2S2 eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa NA DQ894184 No/No FUSION pENTR223 bacterial:spectinomycin
32 HsCD00510215 Plasmid Details cDNA EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa NA DQ894544 No/No FUSION pENTR223 bacterial:spectinomycin
33 HsCD00510284 Plasmid Details cDNA EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa NA DQ894544 No/No FUSION pENTR223 bacterial:spectinomycin
34 HsCD00510560 Plasmid Details cDNA EIF2B1 eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa NA No/No FUSION pENTR223 bacterial:spectinomycin
35 HsCD00512460 Plasmid Details cDNA EIF2B4 eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa NA No/No FUSION pENTR223 bacterial:spectinomycin
36 HsCD00630750 Plasmid Details cDNA EIF2B1 eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa NA No/No FUSION pANT7_cGST bacterial:ampicillin
37 HsCD00650139 Plasmid Details cDNA EIF2B5 eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa targeted domain No/No CLOSED pET15_NESG bacterial:ampicillin
38 HsCD00650620 Plasmid Details cDNA EIF2B5 eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa targeted domain No/No CLOSED pET15_NESG bacterial:ampicillin
39 HsCD00650621 Plasmid Details cDNA EIF2B5 eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa targeted domain No/No CLOSED pET15_NESG bacterial:ampicillin
40 HsCD00650622 Plasmid Details cDNA EIF2B5 eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa targeted domain No/Yes CLOSED pET15_NESG bacterial:ampicillin
41 HsCD00650623 Plasmid Details cDNA EIF2B5 eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa targeted domain No/No CLOSED pET15_NESG bacterial:ampicillin
42 HsUT00699406 Plasmid Details 3'UTR ZFP42 ZFP42 zinc finger protein Sequence Verified: Yes; 3'UTR length: 1485; Forward Primer: ACGAACAAGAATGAACAAGAGGGAAAGTAG; Reverse Primer: ATCCAACCACACGTAAGCCCAA NM_174900 No/No NA P2RP3 bacterial:kanamycin
43 HsCD00730937 Plasmid Details cDNA EIF2S3 eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa NA BC019906 No/No FUSION pANT7_cGST bacterial:ampicillin
44 HsCD00731385 Plasmid Details cDNA EIF2S2 eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa NA BC000934 No/No FUSION pANT7_cGST bacterial:ampicillin
45 HsCD00731908 Plasmid Details cDNA EIF2B3 eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa NA AL834288 No/No FUSION pANT7_cGST bacterial:ampicillin
46 HsCD00732308 Plasmid Details cDNA EIF2B2 eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa NA BC000494 No/No FUSION pANT7_cGST bacterial:ampicillin
47 HsCD00817572 Plasmid Details cDNA EIF2B3 eukaryotic translation initiation factor 2B subunit gamma "insert_ID 57160,DNASU_Clone_ID HsCD00082288" AL834288 No/No FUSION pJFT7_nHalo_DC(r4) bacterial:ampicillin
No of Result Per Page : Page: